View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13076_high_28 (Length: 311)
Name: NF13076_high_28
Description: NF13076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13076_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 181 - 293
Target Start/End: Original strand, 14130823 - 14130939
Alignment:
| Q |
181 |
aatctcatcaccacctccatattttaagatgaattttaattatcatagttagctccttaatcctttaatcttagctct----gccccttccctctctgca |
276 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14130823 |
aatctcatcaccacctccatattttaaaatgaattttaattatcatagttagctccttaatcctttaatcttagctctgctggccccttccctctctgca |
14130922 |
T |
|
| Q |
277 |
tatcccttcctggatat |
293 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14130923 |
tatcccttcctggatat |
14130939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 14130711 - 14130807
Alignment:
| Q |
8 |
agcaatatgaagaatgtacgtagaagatctgaagatggaaaagccaaccaaaccctagtgcaattaaatatttatccccataacattacagatgataccg |
107 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14130711 |
agcaatatgaagaatgta----gaagatctgaagatggaaaagccaaccaaaccctagtgcaattaaatatttatccccataacattacagatgataccg |
14130806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University