View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13076_high_30 (Length: 306)
Name: NF13076_high_30
Description: NF13076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13076_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 113 - 289
Target Start/End: Original strand, 33222748 - 33222924
Alignment:
| Q |
113 |
aaatcatagtccatacctggctgtatccttcatcatcttcactctcatcatcttcttttatcatgtcgatgtttgcatgatttccaagtgttacgcaata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33222748 |
aaatcatagtccatacctggctgtatccttcatcatcttcactctcatcatcttcttttatcatgtcgatgtttgcatgatttccaagtgttacgcaata |
33222847 |
T |
 |
| Q |
213 |
ctcgtcaccgcaaagactgtttcccatgtgattacagacttacacagacatgtacaacactagaaagggtcttaact |
289 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33222848 |
ctcatcaccgcaaagactgtttcccatgtgattacagacttacacacacatgtacaacactagaaagggtcttaact |
33222924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 119 - 201
Target Start/End: Original strand, 33231307 - 33231389
Alignment:
| Q |
119 |
tagtccatacctggctgtatccttcatcatcttcactctcatcatcttcttttatcatgtcgatgtttgcatgatttccaagt |
201 |
Q |
| |
|
|||||||| ||| | |||||||| ||||||| |||||||||||||||||||||| ||||| |||| | |||| |||| ||||| |
|
|
| T |
33231307 |
tagtccatcccttgttgtatcctccatcatcgtcactctcatcatcttcttttaccatgttgatggtagcattattttcaagt |
33231389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University