View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13076_high_38 (Length: 250)
Name: NF13076_high_38
Description: NF13076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13076_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 25 - 245
Target Start/End: Complemental strand, 37881828 - 37881608
Alignment:
| Q |
25 |
tatcattcagctccacagtgtattgggaaacaagtacgtgtgctcatcaaattttaattggaatgaaagtgtcctaaaaatttttaattgtnnnnnnnta |
124 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||| || |
|
|
| T |
37881828 |
tatcattcagctccacagtgtcttgggaaacaagtacgtgtgttcatcaaattttaattggaatgaaagcgtcctaaatttttttaattgtaaaaaaata |
37881729 |
T |
 |
| Q |
125 |
tatcgatttggattctcttcagtggctgcatgatgcagcatctcacagactcttagatttagatatatctttaaatctaaggattttgtgcggccgctgc |
224 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
37881728 |
tgtcgatttggattctcttcagtgactgcatgatgcagcacctcacagactcttagatttagatatatctctaaatctaaggattttgtgcgaccgctgc |
37881629 |
T |
 |
| Q |
225 |
aggtgatcagtacaataattt |
245 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
37881628 |
agatgatcagtacaataattt |
37881608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University