View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13076_low_13 (Length: 419)
Name: NF13076_low_13
Description: NF13076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13076_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 13 - 347
Target Start/End: Original strand, 55076608 - 55076942
Alignment:
| Q |
13 |
aatatgcttcaaggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatgg |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076608 |
aatatgcttcaaggaccctgtcgtgccttccttggtgaccttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatgg |
55076707 |
T |
 |
| Q |
113 |
ccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076708 |
ccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaa |
55076807 |
T |
 |
| Q |
213 |
tctcaaaacatgtttcttcttatcaatattccttctcgctctcgtttcttcctttgctctatattacgtagaagacattccgctccaatcaaaaccacaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55076808 |
tctcaaaacatgtttcttcttatcaatattccttctcgctctcgtttcttcctttgctctatattacgttgaagacattccgctccaatcaaaaccacaa |
55076907 |
T |
 |
| Q |
313 |
tcacaatcaaaggtaattaacttgtgtcccctcca |
347 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
55076908 |
tcacaatcaaaggtaattaacttgcgtcccctcca |
55076942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 15125445 - 15125312
Alignment:
| Q |
13 |
aatatgcttcaaggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatgg |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |||| ||||||||||||||||||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
15125445 |
aatatgcttcaaggaccttgtcgtgccttcattggtgacctcgctggtggtgatcaccgtcgaatgagaattggcaatgggatgttctcttttttcatgg |
15125346 |
T |
 |
| Q |
113 |
ccgtgggaaatatccttggttatgccgccggctc |
146 |
Q |
| |
|
|||| || ||| ||||||||||||| || ||||| |
|
|
| T |
15125345 |
ccgtcggtaatgtccttggttatgctgctggctc |
15125312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 109 - 191
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
| Q |
109 |
atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc |
191 |
Q |
| |
|
|||||||| || || ||||| ||||| |||||||| ||| ||||||||||| |||| ||||||| |||||| |||| ||||| |
|
|
| T |
43665688 |
atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc |
43665606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University