View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13076_low_42 (Length: 227)
Name: NF13076_low_42
Description: NF13076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13076_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 488229 - 488450
Alignment:
| Q |
1 |
caacctggtatatctccaatagcacttagtagacacctactgcaatcattagctgctagatctctggtacactgcactaaggcatatattgttttatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488229 |
caacctggtatatctccaatagcacttagtagacacctactgcaatcattagctgctagatctctggtacactgcactaaggcatatattgttttatctt |
488328 |
T |
 |
| Q |
101 |
caaagggtacttctccagtagcatacatattagcggaaacattaaaagatgctatcttggtaagaacattcaacaacttattcacagaagactcaaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
488329 |
caaagggtacttctccagtagcatacatattagcagaaacattaaaagatgctatcttggtaagaccattcaacaacttattcacagaagtctcaaattt |
488428 |
T |
 |
| Q |
201 |
tacgggctccgaaatattctgt |
222 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
488429 |
tacaggctccgaaatattctgt |
488450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University