View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13078_high_5 (Length: 232)
Name: NF13078_high_5
Description: NF13078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13078_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 52026780 - 52026582
Alignment:
| Q |
15 |
ttattcttagtcaaataatgagaaaaagtactatgaaggaaattggaggaagaaagaaaacatatgataagaaagaaatatgtcattttaaaattttatg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||| |||||| |
|
|
| T |
52026780 |
ttattcttagtcaaataatgagaaaaagtactatgaaggaaattggaggaagaaagaaaacat--gacaagaaagaactatgtcattttaaaaatttatg |
52026683 |
T |
|
| Q |
115 |
atggatgaatgaggacgaagagcgttgaacataatttaagttgattttgccccgagggttttgtaaggggttgcccctcgcataccaacatgtcagaatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52026682 |
atggatgaatgaggacgaagagcgttgaacataatttaagctgattttgccccgagggttttgcaaggggttgcccctcgcataccaacatgtcagaatg |
52026583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University