View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13078_low_7 (Length: 205)
Name: NF13078_low_7
Description: NF13078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13078_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 23 - 189
Target Start/End: Original strand, 54985804 - 54985975
Alignment:
| Q |
23 |
ttcactactaccaattattggaggttgtgcacttgctgctgtcacagaacttaatttcaatatgattggtaagactacattcactt-----atttacatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54985804 |
ttcactactaccaattattggaggttgtgcacttgctgctgtcacagaacttaatttcaatatgattggtaagactacattcacttatttaatttacatg |
54985903 |
T |
|
| Q |
118 |
gttgattttcagatgctgattgtgttcttctatcatagtagattgaggtgatattggatgctgaatctgtat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
54985904 |
gttgattttcagatgctgattgtgttcttctatcatagtagattgagttgatataggatgctgaatctgtat |
54985975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 33 - 93
Target Start/End: Original strand, 7883377 - 7883437
Alignment:
| Q |
33 |
ccaattattggaggttgtgcacttgctgctgtcacagaacttaatttcaatatgattggta |
93 |
Q |
| |
|
||||| ||||| ||||||||||| |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
7883377 |
ccaataattggtggttgtgcactagctgctgtaacagaactcaatttcaatatgattggta |
7883437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 18396163 - 18396224
Alignment:
| Q |
33 |
ccaattattggaggttgtgcacttgctgctgtcacagaacttaatttcaatatgattggtaa |
94 |
Q |
| |
|
||||| ||||| || ||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
18396163 |
ccaatcattggtggatgtgcacttgctgctgtgactgaactcaatttcaatatgattggtaa |
18396224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University