View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1307_high_21 (Length: 324)
Name: NF1307_high_21
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1307_high_21 |
 |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold1236 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (2 HSPs) |
 |  |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
| [»] scaffold0519 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0999 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 211)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 75 - 321
Target Start/End: Original strand, 8780793 - 8781040
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
8780793 |
ggatattgcatattatatgcaggggccgaggttcaaacctcggacaccccacttctccacatttaaaatgtgcgagatctaaccactgagctgcttgacc |
8780892 |
T |
 |
| Q |
174 |
nnnnnnnngtttcattatggttatcttagaaatttcaatagctgcacatgacaacgaaccctcataaactagtgaaagacatttcttgtagataactcta |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8780893 |
aaataaaagtttcattatggttatcttagaaatttcaatagctgcacatgacaacgaaccctcataaactagtgaaagacatttcttgtagataactcta |
8780992 |
T |
 |
| Q |
274 |
gaattctatttaatgttaggtaatttttcatccaatattattcgacat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
8780993 |
gaattctatttaatgttaggtaatttttcatccaatgtttttcgacat |
8781040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 1570240 - 1570138
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
1570240 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
1570141 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
1570140 |
acc |
1570138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 6438112 - 6438010
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
6438112 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
6438013 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
6438012 |
acc |
6438010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 15819649 - 15819547
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
15819649 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
15819550 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
15819549 |
acc |
15819547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 21265678 - 21265780
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
21265678 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
21265777 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
21265778 |
acc |
21265780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 75 - 163
Target Start/End: Complemental strand, 18551678 - 18551589
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
18551678 |
ggatattgcatattatatgcaggggccggggtttgaaccccgaacactccacttctccacaattaaattgtgcgagctctaaccactagg |
18551589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 22563408 - 22563509
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
22563408 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
22563507 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
22563508 |
ac |
22563509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 40375363 - 40375262
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | |||||||||||||| ||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
40375363 |
tagggatattgcatattatatgcaggagccggggtacgaaccccggacactctacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
40375264 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
40375263 |
ac |
40375262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 7191054 - 7191145
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
7191054 |
tagggatattgcatattatatgcaggggctggggttcgaaccccggacacctcacttctccacaattaaattgtgtgagctctagccactag |
7191145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 26550516 - 26550607
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| |||||||||||||| |||||||||| ||||| |||| || ||||||||||||| |
|
|
| T |
26550516 |
tagggatattgcatactatatgcaggagccggggttcgaaccccggacactcccttctccacaattaaattgtgttagctctaaccactagg |
26550607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 7166275 - 7166173
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
7166275 |
tagggatattgcatattatatgcaggggctggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
7166176 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
7166175 |
acc |
7166173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 13538494 - 13538404
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| || || |||| ||| |||| |||||| |
|
|
| T |
13538494 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagttctagccacta |
13538404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 16343050 - 16343140
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
16343050 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccacta |
16343140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 25999872 - 25999974
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| || |||| |
|
|
| T |
25999872 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagattacttg |
25999971 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
25999972 |
acc |
25999974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 32594273 - 32594375
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
32594273 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
32594372 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
32594373 |
acc |
32594375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 46965762 - 46965864
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||| | ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
46965762 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgagctctagccactaggctacttg |
46965861 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
46965862 |
acc |
46965864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 2277776 - 2277877
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
2277776 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggagactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
2277875 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
2277876 |
ac |
2277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 13773190 - 13773291
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| || |||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
13773190 |
tagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
13773289 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
13773290 |
ac |
13773291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 6712157 - 6712065
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| | || ||| |||| |||||||| |
|
|
| T |
6712157 |
taggtatattgcattttatatgcaggggccggggttcaaaccccggacactctacttctccacaattaaattatgtgagctctagccactagg |
6712065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 186 - 309
Target Start/End: Original strand, 8786614 - 8786738
Alignment:
| Q |
186 |
cattatggtta-tcttagaaatttcaatagctgcacatgacaacgaaccctcataaactagtgaaagacatttcttgtagataactctagaattctattt |
284 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||||||||| | ||||||||||| | | ||| ||||||| | ||||||||||| | |||||||| |
|
|
| T |
8786614 |
cattatggttaatcttagaaatttcgataaatgcacatgacaacaatccctcataaaccaatcaaacacatttcctatagataactctggctttctattt |
8786713 |
T |
 |
| Q |
285 |
aatgttaggtaatttttcatccaat |
309 |
Q |
| |
|
|||||| |||| ||||||||||||| |
|
|
| T |
8786714 |
aatgtttggtagtttttcatccaat |
8786738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 42490458 - 42490366
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||| | |||||||||||| ||||| |||| || ||||||||||||| |
|
|
| T |
42490458 |
tagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtgtgaactctaaccactagg |
42490366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 40519592 - 40519489
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggcc-ggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgctt |
169 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | ||| |
|
|
| T |
40519592 |
tagggatattgcatattatatgcaggagccgggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctactt |
40519493 |
T |
 |
| Q |
170 |
gacc |
173 |
Q |
| |
|
|||| |
|
|
| T |
40519492 |
gacc |
40519489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 43884816 - 43884907
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
43884816 |
tagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagttctagccactag |
43884907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 165
Target Start/End: Complemental strand, 1604272 - 1604178
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggtt |
165 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||||| ||||| || |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
1604272 |
tagggatattgcatattatatgtaggggtcggggttcgaacccttgacaccacaattctccacatttaaaatgtgtgagctctaaccactaggtt |
1604178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 2754382 - 2754472
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||| | ||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
2754382 |
tagggatattgcatattatatgccggggccggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagctctagccacta |
2754472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 12502302 - 12502200
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| || |||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
12502302 |
tagggatattgcatattatatgcaggagtcggggttcgaaacccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
12502203 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
12502202 |
acc |
12502200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 34058236 - 34058338
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
34058236 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccattaggctacttg |
34058335 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
34058336 |
acc |
34058338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 4482646 - 4482545
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
4482646 |
tagggatattgcatattatatgcaggagccggagttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
4482547 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
4482546 |
ac |
4482545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 16526225 - 16526124
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||| ||||||| ||||| |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
16526225 |
tagggatattgcatattatatgcaggagcctgtgttcgaaccccgtacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
16526126 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
16526125 |
ac |
16526124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 73 - 172
Target Start/End: Complemental strand, 8984552 - 8984453
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| || |||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | ||||| |
|
|
| T |
8984552 |
agggatattgcatattatatgcaggagccggggttcgaa-cccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttga |
8984454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 18467246 - 18467154
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| |
|
|
| T |
18467246 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactagg |
18467154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 74 - 145
Target Start/End: Original strand, 36860622 - 36860694
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| | ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
36860622 |
gggatattgcatattatatgcagaggccggggtccgaaccccggacaccccacttctccacatttaaaatgtg |
36860694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 29188658 - 29188749
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
29188658 |
tagggatattgcatattatatgcaggagcaggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactag |
29188749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 33033148 - 33033239
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||| |||| | || ||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
33033148 |
tagggatattgcatattatatgcagggaccggggttcgaaccctagacaccccatttctccacaattaaaatgtgtgagctctaaccactag |
33033239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 33207227 - 33207290
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
33207227 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccaca |
33207290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 77 - 163
Target Start/End: Complemental strand, 39347022 - 39346935
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
39347022 |
atattgcattttatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctagccactagg |
39346935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 44732655 - 44732746
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||| | |||||||||||| ||||| |||| || |||| ||||||| |
|
|
| T |
44732655 |
tagggatattgcatattatatgcaagggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgaactctagccactag |
44732746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 50899558 - 50899495
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
50899558 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccaca |
50899495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 6893285 - 6893183
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| ||||||||||||| ||||| |||||| ||||| |||| ||| ||| |||||||| | |||| |
|
|
| T |
6893285 |
tagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccacttttccacaattaaattgtgtgagctctggccactaggctacttg |
6893186 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
6893185 |
acc |
6893183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 11215023 - 11215125
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| |||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
11215023 |
tagggatattgcatattatatgcaggggctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
11215122 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
11215123 |
acc |
11215125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 81 - 162
Target Start/End: Complemental strand, 18512614 - 18512532
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||| ||| || | ||||||| |
|
|
| T |
18512614 |
tgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
18512532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 73 - 154
Target Start/End: Original strand, 23233974 - 23234056
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||| ||||| | ||||||||||||||| |||||| ||| |||| |
|
|
| T |
23233974 |
agggatattgcatattatatgcaggggtcggggttcgaaccccagacaccctacttctccacatttataatgtgtgagctcta |
23234056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 26584794 - 26584692
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||| ||||| |||||||| ||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
26584794 |
tagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctctacaattaaattgtgtgagctctagccactaggctacttg |
26584695 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
26584694 |
acc |
26584692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 48638554 - 48638656
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |||||| |||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
48638554 |
tagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaactgtgtgagctctagccactaggctacttg |
48638653 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
48638654 |
acc |
48638656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 7180662 - 7180561
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| ||||||| | |||| |
|
|
| T |
7180662 |
taggaatattgcatattatatgcaggggccggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagtcactaggctacttg |
7180563 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
7180562 |
ac |
7180561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 12048172 - 12048071
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||| || |||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
12048172 |
tagggatattgtatattatatgcaggggctggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
12048073 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
12048072 |
ac |
12048071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 73 - 154
Target Start/End: Original strand, 12662711 - 12662792
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| || | |||||||||||||||| |||||| || |||| ||| |||| |
|
|
| T |
12662711 |
agggatattgcatattatatgcaggggccggagttcgaaactcggacactcacttctctacattttaattgtgtgagttcta |
12662792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 19011377 - 19011478
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| || ||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
19011377 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
19011476 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
19011477 |
ac |
19011478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 42054355 - 42054455
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| ||||| | |||||||||||| || || |||| ||| ||| ||||||||||| |||| |
|
|
| T |
42054355 |
tagggatattgcatattatatgtaggggccggggttcgaaccctggacattccacttctccacaatttaactgtgtgagctct-accactaggttacttg |
42054453 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
42054454 |
ac |
42054455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 48897165 - 48897064
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| ||| ||||||||| |||||||||| | || || |||| ||| ||||||||||||| | |||| |
|
|
| T |
48897165 |
taggaatattgcatattatatgcaggggccagggttcgaacaccggacactccacttctccataatttaattgtgtgagctctaaccactaggctacttg |
48897066 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
48897065 |
ac |
48897064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 77 - 172
Target Start/End: Complemental strand, 4553589 - 4553493
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| || | ||||||| ||||||||||||| ||||| |||| ||| |||||||||||| || |||||| |
|
|
| T |
4553589 |
atattgcatattatatgcaggggctgaggttcgaatctcggacacctcacttctccacaattaaattgtgtgagctctaaccactagattacttgac |
4553493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 15775761 - 15775853
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |||||| ||||||| |||||| |||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
15775761 |
tagggatattgcatattatatgcaggagccggagttcgaaccccagacactcaacttctacacaattaaattgtgtgagctctagccactagg |
15775853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 76 - 163
Target Start/End: Original strand, 18534027 - 18534115
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
18534027 |
gatattgcatattatatgtaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagg |
18534115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 27818591 - 27818691
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| ||| || ||||| |||||||||||| ||||| |||| ||| |||| |||||||| | ||||| |
|
|
| T |
27818591 |
tagggatattgcatattatattcatgggccggggtttgaactccagacacccacttctccacaattaaattgtgtgagctctagccactaggctacttga |
27818690 |
T |
 |
| Q |
172 |
c |
172 |
Q |
| |
|
| |
|
|
| T |
27818691 |
c |
27818691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 33254750 - 33254842
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| |
|
|
| T |
33254750 |
tagggatattgcatattatatgcaggagtcggggttggaaccccggacactccacttctccacaattaaattgtgtgagctctagccattagg |
33254842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 33274922 - 33275014
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| |
|
|
| T |
33274922 |
tagggatattgcatattatatgcaggagtcggggttggaaccccggacactccacttctccacaattaaattgtgtgagctctagccattagg |
33275014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 47930719 - 47930627
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||| |||| | | ||||||| |||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
47930719 |
tagggatattgcatattatatgcaggggctggggttcgaacctcggataccccacttcttcacaattaaattgtgtgagctctaaccactagg |
47930627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 30443 - 30360
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| |||||||||| || |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
30443 |
tagggatattgcattttatatgcaggagccggggttcgaaccccggacgctccacttctccacaattaaattgtgtgagttcta |
30360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 6130081 - 6129998
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||| ||||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
6130081 |
tagggatattgcatattatatgcaggagtcggggttcgaactccggacactccacttctccacaattaaattgtgtgagctcta |
6129998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 6463084 - 6463021
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
6463084 |
tagggatattgtattttatatgcaggggccggggttcgaaccccggacactccacttctccaca |
6463021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 9866232 - 9866141
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || |||| ||||| ||||| |||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
9866232 |
tagggatattgcatattatatgcaggggtcggggttcgaatcccgaacactccacttttccacaattaaattgtgtgagctctagccactag |
9866141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 32556977 - 32556886
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||| ||||||| ||||||||||| ||||| |||| || |||||||||||| |
|
|
| T |
32556977 |
tagggatattgcatattatatgcagaggttggggttcaaacccgagacactctacttctccacaattaaattgtgtgacttctaaccactag |
32556886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 37662605 - 37662514
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| | ||||||||||| | |||||||| ||| ||||| |||| ||| || ||||||||| |
|
|
| T |
37662605 |
tagggatattgcatattatatgcaggggtcggggtacgaaccccggacaccccacttctctacagttaaattgtgtgagctccaaccactag |
37662514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 46021927 - 46021876
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
46021927 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactc |
46021876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 76 - 154
Target Start/End: Original strand, 11065146 - 11065223
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||| ||||||||||| ||||||||||| ||| |||| |
|
|
| T |
11065146 |
gatattgcatattatatgcaggggtcggggttcaaaccctaaacac-cacttctccacctttaaaatgtgtgagttcta |
11065223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 17776862 - 17776964
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||| ||||||||||||| | |||||| |||| |||||| | |||||||||||| ||||| |||||||| |||| |||||||| | |||| |
|
|
| T |
17776862 |
taggcatattgcattttatatgcaggggtcagggttcgaacctcggacatttcacttctccacaattaaattgtgcgagctctagccactaggctacttg |
17776961 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
17776962 |
acc |
17776964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 19063377 - 19063291
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||| || || |||| ||| |||||| |||| |
|
|
| T |
19063377 |
gatattgcatattatatgcaggggccggggttcgtaccccggacaccccacttctccacaatttaattgtgtgagctctaactacta |
19063291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 26820709 - 26820607
Alignment:
| Q |
72 |
tagggatattgcatatt-atatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgctt |
169 |
Q |
| |
|
||||||||||| ||||| ||||||||||| |||| || |||||||||||| | || ||||||||| ||||| |||||||| |||| |||||||||| ||| |
|
|
| T |
26820709 |
tagggatattgaatatttatatgcaggggtcgggatttaaaccccggacaccccatttctccacaattaaattgtgcgagctctagccactaggttactt |
26820610 |
T |
 |
| Q |
170 |
gac |
172 |
Q |
| |
|
||| |
|
|
| T |
26820609 |
gac |
26820607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 77 - 154
Target Start/End: Original strand, 27234014 - 27234092
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||| ||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
27234014 |
atattgcatattatatgcaggggccggggttcgaatcccgaacactccacttctccacaattaaattgtgtgagctcta |
27234092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 88 - 173
Target Start/End: Complemental strand, 32589521 - 32589435
Alignment:
| Q |
88 |
tatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||| |||||||||| |||||||| ||||| ||||||||||| ||||| |||| ||| ||||||||||||| | ||||||| |
|
|
| T |
32589521 |
tatatgcaggagccggggttcgaaccccggtcactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgacc |
32589435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 43668001 - 43667915
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||| ||| | |||||||||||| ||||| |||| ||| ||||||||||| |
|
|
| T |
43668001 |
gatattgcatattatatgcaggaaccggggttcgaaccccgaacattccacttctccacaattaaattgtgtgagttctaaccacta |
43667915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 1151781 - 1151882
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| ||| ||||||||||||| ||||||| |||| ||||| |||| ||| |||| ||||||| | |||| |
|
|
| T |
1151781 |
tagggatattgcatattatatacaggagccgggattcgaaccccggacactccacttcttcacaattaaattgtgtgagctctagtcactaggctacttg |
1151880 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
1151881 |
ac |
1151882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 6702598 - 6702699
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |||||| |||||| ||||||| |||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
6702598 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttcttcacaattaaattgtgtgagctctagccattaggctacttg |
6702697 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
6702698 |
ac |
6702699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 10664842 - 10664742
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||| ||||||||||||| |||||||||||| ||||| ||| ||| |||| |||||||| | |||| |
|
|
| T |
10664842 |
tagggatattgcatattatatgca-gagtcggggttcgaaccccggacactccacttctccacaattaaattgtatgagctctagccactaggctacttg |
10664744 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
10664743 |
ac |
10664742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 28564393 - 28564292
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||| |||| |||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
28564393 |
tagggatattgcagattatatgcaggggttggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
28564294 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
28564293 |
ac |
28564292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 73 - 173
Target Start/End: Complemental strand, 45333758 - 45333658
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| |||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| | ||||| |
|
|
| T |
45333758 |
agggatattgcatat-atatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttga |
45333660 |
T |
 |
| Q |
172 |
cc |
173 |
Q |
| |
|
|| |
|
|
| T |
45333659 |
cc |
45333658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 45517316 - 45517215
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| || ||||||||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
45517316 |
tagggatattgcattttatatacaggggccgggattggaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
45517217 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
45517216 |
ac |
45517215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 8415751 - 8415795
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8415751 |
tagggatattgcatattatatgcaggggtcggggttcaaaccccg |
8415795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 8865876 - 8865968
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||| ||||| ||||||| |||||||||||| || || |||| ||| ||| |||||||| |
|
|
| T |
8865876 |
tagggatattgcatattatatgcaggggtcgggattcgaaccctggacactccacttctccacaatttaattgtgtgagttctggccactagg |
8865968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 17671458 - 17671366
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||| |||| | ||||||||||||||| |||| ||||||||||||| |||||||||||| ||||| |||| ||| | || |||||||| |
|
|
| T |
17671458 |
tagggatatcgcatttcatatgcaggggccggagttcgaaccccggacactccacttctccacaattaaattgtgtgagctttagccactagg |
17671366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 16313754 - 16313663
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| || | || |||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
16313754 |
taggaatattgcatattatatgcaggagccggagtacgaatcccggacactccacttctccacaattaaattgtgggagctctagccactag |
16313663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 34580834 - 34580743
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||| |||||||||||||| || ||||||| |||||||||||| | ||||||||||| || || ||| ||| |||||||||||| |
|
|
| T |
34580834 |
tagggatattgtatattatatgcaggagctggggttcgaaccccggacactttacttctccacaatttaattgtatgagctctaaccactag |
34580743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 36314027 - 36313937
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| ||||||| ||| | |||||||||||| ||| |||||| ||| || ||||||||| |
|
|
| T |
36314027 |
tagggatattgcatattatttgcaggggccggagttcgaaccccgaacaccccacttctccaca-ttataatgtgtgagctccaaccactag |
36313937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 50746733 - 50746824
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||| ||||||||||| || || |||| ||| |||||||||||| | ||||||||||| ||||| |||||||| |||||||||||| |
|
|
| T |
50746733 |
tagggatatcacatattatatgtagaggtcgggattcgaaccccggacaccccacttctccacaattaaattgtgcgagctctaaccactag |
50746824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 50824458 - 50824407
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |||||||||||||| |
|
|
| T |
50824458 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggacactc |
50824407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 52369619 - 52369710
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| ||||| ||| ||| |||||||||| | ||||| |||| ||| |||| ||||||| |
|
|
| T |
52369619 |
tagggatattgcatattatatgcaggagccgaggttcgaaccctggatactccacttctccataattaaattgtgtgagctctagccactag |
52369710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 173
Target Start/End: Complemental strand, 2352609 - 2352511
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || |||| ||||| |||||||||||| ||| | |||| ||| |||| ||| |||| | ||||||| |
|
|
| T |
2352609 |
gatattgcatattatatgcaggagccggggttcgaatcccgaacactccacttctccacaattatattgtgtgagctctagccagtaggctacttgacc |
2352511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 5190829 - 5190727
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| |||||||||||||||||| || ||||| ||||||||||| | |||||||||||| ||| | |||| || |||| |||||||| | |||| |
|
|
| T |
5190829 |
tagggatatcgcatattatatgcaggggtcgaggttcgaaccccggacaccccacttctccacaattatattgtgtaagttctagccactaggctacttg |
5190730 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
5190729 |
acc |
5190727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 18216928 - 18217018
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||| |||||| |||||| | |||||||||| ||||||||||||| |||||||| ||| ||||| |||| ||| |||| |||||| |
|
|
| T |
18216928 |
tagggatattacatattttatgcaagagccggggttcgaaccccggacactccacttctctacaattaaattgtgtgagctctagccacta |
18217018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 145
Target Start/End: Original strand, 30360438 - 30360508
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||| ||||||| ||||| |||||||| ||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
30360438 |
gatattgcattttatatgtaggggtcggggttcgaaccccggacactccacttctccacagttaaattgtg |
30360508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 161
Target Start/End: Original strand, 35283527 - 35283613
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| ||||| | ||||| |||||||||||| || || |||| ||| ||||||||||| |
|
|
| T |
35283527 |
gatattacatattatatgcagaggccggggttcgaaccctgaacactccacttctccacaatttaattgtgtgagctctaaccacta |
35283613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 44019298 - 44019400
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||| ||| || |||||||||| |||||||||||| || || |||| ||| |||||||| ||| || |||| |
|
|
| T |
44019298 |
tagggatattgcattttatatgcaagggtcgggattcgaatcccggacactccacttctccacaatttaattgtgtgagctctaaccattagattacttg |
44019397 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
44019398 |
acc |
44019400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 51050212 - 51050314
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||| |||| | |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
51050212 |
tagggatattgtatattatatgcaggggatggggttcgaaccccagacattccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
51050311 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
51050312 |
acc |
51050314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 8741495 - 8741596
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||| ||| |||| | ||||||||||| ||||||| |||||| ||||| | ||||||||||||||| |||||| ||| || |||||||||| | |||| |
|
|
| T |
8741495 |
tagggacattacataatttatgcaggggcaggggttcgaacccctgacaccccacttctccacatttataatgtgtgagctccaaccactaggctacttg |
8741594 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
8741595 |
ac |
8741596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 15390242 - 15390343
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| ||| ||||| ||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
15390242 |
tagggatattgcatattagatgcaggggttgggattcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctacttg |
15390341 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
15390342 |
ac |
15390343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 75 - 163
Target Start/End: Complemental strand, 27579519 - 27579430
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| ||||| ||||| | | |||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
27579519 |
ggatattacatattatatgcaggggccgaagttcgaaccctagacaccccatttctccacatttaaaatgtgtgagctctagccactagg |
27579430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 76 - 160
Target Start/End: Complemental strand, 34656439 - 34656354
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| |||| |||||||| |||||||||||| ||||| |||| ||| |||| ||||| |
|
|
| T |
34656439 |
gatattgcattttatatgcaggggttggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccact |
34656354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 80 - 136
Target Start/End: Original strand, 35068717 - 35068774
Alignment:
| Q |
80 |
ttgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatt |
136 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
35068717 |
ttgcatattatatggaggggccggggttcgaaccccggacaccccacttctccacatt |
35068774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 84 - 172
Target Start/End: Complemental strand, 40211561 - 40211472
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||| | |||||||| |||||||||||| ||||||||||||| ||||| |||| ||| | || |||||||| | |||||| |
|
|
| T |
40211561 |
atattatatgcaggagtcggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctatagccactaggctacttgac |
40211472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 42550057 - 42549956
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggac-actcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||| |||| | ||| | |||||||||||| ||||| |||| ||| |||| |||||||| |||||| |
|
|
| T |
42550057 |
tagggatattgcatattacatgcaggggccgaggttttaacctcagacgccccacttctccacaattaaattgtgtgagttctagccactaggctgcttg |
42549958 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
42549957 |
ac |
42549956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 47643032 - 47642940
Alignment:
| Q |
72 |
tagggatattgcatattatat--gcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||||||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
47643032 |
tagggatattgcattttatatatgcagaggccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccacta |
47642940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 120
Target Start/End: Original strand, 2556578 - 2556626
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| |||| |
|
|
| T |
2556578 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagaca |
2556626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 120
Target Start/End: Original strand, 3269641 - 3269689
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
3269641 |
tagggatattgcatattatatgcaggggctggggttcgaaccctggaca |
3269689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 11333686 - 11333754
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | |||||||||||||| |||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
11333686 |
tagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccacatttaa |
11333754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 11491707 - 11491775
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | |||||||||||||| |||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
11491707 |
tagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccacatttaa |
11491775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 81 - 136
Target Start/End: Complemental strand, 16997298 - 16997242
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatt |
136 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||||||||||| |||||||||||||||| |
|
|
| T |
16997298 |
tgcatattttatgcaggggccgaggttcgaaccccggacacctcacttctccacatt |
16997242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 19424066 - 19424114
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
19424066 |
agggataatgcatattatatgcaggggtcggggttcgaaccccggacac |
19424114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 24910526 - 24910458
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||| | |||||||||| | |||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
24910526 |
tagggatattgcataatttatgcaggggtcagggttcgaaccccggacactccacttctccatatttaa |
24910458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 35605671 - 35605579
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| ||| | |||||||||||| ||||| |||| ||| |||| | |||||| |
|
|
| T |
35605671 |
tagggatattgcatattatatgcaggggtcggggttcgaaccctaaacaccccacttctccacaattaaattgtgtgagctctagctactagg |
35605579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 36666624 - 36666556
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||||| ||||||||||| | |||||||||||| |||| |
|
|
| T |
36666624 |
tagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacaattaa |
36666556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 52426961 - 52426893
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||| || |||| | || |||||||||||||| |
|
|
| T |
52426961 |
tagggatattgcatattatatgcaggggccgtggttcgaactccagacaccccatttctccacatttaa |
52426893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 73 - 159
Target Start/End: Complemental strand, 3694962 - 3694876
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| || ||||||||| |||||||||||| || || |||||||| |||| |||| |
|
|
| T |
3694962 |
agggatattgcatattatatgtaggagccggggttcgaa-tccggacactccacttctccacaatttaattgtgcgagctctagccac |
3694876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 5862994 - 5863085
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| |||||||||| || ||||| |||| ||| |||||||| |||||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
5862994 |
tagggatattacatattatatccaagggccaaggtttgaactccggacacctcacttctccgtatttaaaatgtgtgagttctaaccactag |
5863085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 21401481 - 21401390
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| |||| || ||| | |||||||||||| ||||| |||| ||| | || ||||||| |
|
|
| T |
21401481 |
taggaatattgcatattatatgcaggggccgcggttcgaacctcgaacaccacacttctccacaattaaattgtgtgagctttagccactag |
21401390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 74 - 121
Target Start/End: Complemental strand, 23369100 - 23369053
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
23369100 |
gggatattgtatattatatgcaggggccgcggttcgaaccccggacac |
23369053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 73 - 139
Target Start/End: Complemental strand, 23991311 - 23991244
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||| ||||| ||||| | ||||||||||||||||| |
|
|
| T |
23991311 |
agggacattgcataatttatgcaggggccggggttcgaaccctggacaccccacttctccacatttaa |
23991244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 76 - 158
Target Start/End: Original strand, 25580714 - 25580797
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
||||||||||||||||||| || | | |||||| ||||| |||||| ||||||||||||| ||||| |||| ||| |||||||| |
|
|
| T |
25580714 |
gatattgcatattatatgccggagtcagggttcgaaccctggacacttcacttctccacaattaaattgtgtgagttctaacca |
25580797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 161
Target Start/End: Complemental strand, 27178753 - 27178667
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| || | |||||| | |||||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
27178753 |
ggatattgtatattatatgcaggggccggaattcgaatctcggacaccccacttctccaca-ttaaaatgtgtgagctctaaccacta |
27178667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 27642774 - 27642684
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| ||||||||| |||| || |||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
27642774 |
tagggatattgcattttatatgca-gggctggagttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactag |
27642684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 40520852 - 40520903
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| |||||| ||||||| |
|
|
| T |
40520852 |
tagggatattgcatattatatgcatgggctggggttcgaaccccagacactc |
40520903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 40634223 - 40634274
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
40634223 |
tagggatattgcatattatatgcaggggatggggttcgaaccccgggcactc |
40634274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 115
Target Start/End: Original strand, 45271788 - 45271831
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaacccc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
45271788 |
tagggatattgcatattatatgcaggggtcgaggttcaaacccc |
45271831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 73 - 163
Target Start/End: Complemental strand, 47469120 - 47469030
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||| | ||||||||||| | ||||| ||||||||||| | ||||||||||||||| || |||| ||| ||||||||||||| |
|
|
| T |
47469120 |
agggacattgcataatttatgcaggggctgaggttcgaaccccggacaccccacttctccacattt-aattgtgtgagctctaaccactagg |
47469030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 923152 - 923078
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||| ||| ||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
923152 |
tagggatattgcatattatatgcaggaggcggagttcgaactccgcacactccacttctccacaattaaattgtg |
923078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 76 - 145
Target Start/End: Original strand, 14349670 - 14349740
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| ||||||||||||| || ||||||||| ||||| |||| |
|
|
| T |
14349670 |
gatattgcatattatatgtagggatcggggttcgaaccccggacactacatttctccacaattaaattgtg |
14349740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 159
Target Start/End: Complemental strand, 14403793 - 14403703
Alignment:
| Q |
75 |
ggatattgcatat---tatatgcaggggccggggttcaaaccccggaca---ctcacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| ||||| ||||| |||| |||||||||||||||||||| || ||||||||| |
|
|
| T |
14403793 |
ggatattgcatatatttatatgcaggagccggggttcgaaccctggacatctctcatttctccacatttaaaatgtgtgatctctaaccac |
14403703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 76 - 145
Target Start/End: Original strand, 16182224 - 16182294
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||| |||| || |||| || |||| |||| | |||||||||||||||||||||| |
|
|
| T |
16182224 |
gatattgcatattatatgcatgggctggagttcgaatcccgaacaccccacttctccacatttaaaatgtg |
16182294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 27784104 - 27784030
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||| ||||||||||||||||||| | | ||| ||||| ||||||| |||||||||||| ||||| |||| |
|
|
| T |
27784104 |
tagggatatcgcatattatatgcaggggctgtgattcgaaccctggacactccacttctccacaattaaattgtg |
27784030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 33130769 - 33130843
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| ||||||| |||| || ||||||||| ||||| |||| |
|
|
| T |
33130769 |
tagggttattgcatattatatgcaggggtcggggttcgaaccccgaacacgccatttctccacaattaaattgtg |
33130843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 42458247 - 42458150
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||| |||||||||| ||||||| ||||||| |||| ||||||||| ||||||||||| || || |||| || |||| |||||||||| |||||| |
|
|
| T |
42458247 |
ggatattacatattatatacaggggc-ggggttcgaacctcggacactccacttctccacaatttaattgtgtgaactctagccactaggttacttgac |
42458150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 46161171 - 46161097
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||| ||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
46161171 |
taggaatattgcatattatatgcaggagccgatgttcgaaccccgaacactccacttctccacaattaaattgtg |
46161097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 75 - 139
Target Start/End: Original strand, 1247280 - 1247345
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||| | |||||||||| || ||||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
1247280 |
ggatattgcataatttatgcaggggtcgaggttcgaaccccagacacctcacttctccacatttaa |
1247345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 79 - 140
Target Start/End: Complemental strand, 8841279 - 8841218
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaa |
140 |
Q |
| |
|
||||| ||||||||||||||| || ||||| |||||||||||| | ||||||||| |||||| |
|
|
| T |
8841279 |
attgcgtattatatgcaggggtcgaggttcgaaccccggacaccctcttctccacgtttaaa |
8841218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 12404378 - 12404446
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| ||||||| ||| | |||||||||||| ||||| |
|
|
| T |
12404378 |
tagggatattgcatattatatgca-gggctggggttcgaaccccgaacaccccacttctccacaattaaa |
12404446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 81 - 145
Target Start/End: Original strand, 13763792 - 13763857
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||||||||| | | |||||||| |||||||||||||| |
|
|
| T |
13763792 |
tgcattttatatgcaggggctggggttcgaaccccggataccccacttctctacatttaaaatgtg |
13763857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 70 - 115
Target Start/End: Original strand, 31818614 - 31818659
Alignment:
| Q |
70 |
gctagggatattgcatattatatgcaggggccggggttcaaacccc |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
31818614 |
gctaggaatattgcatattatatgcaggagccggggttcgaacccc |
31818659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 81 - 145
Target Start/End: Original strand, 33200070 - 33200135
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| |||||| ||||| ||||||||||| |||||||||| |||||||||||||| || ||||| |
|
|
| T |
33200070 |
tgcataatatatgtaggggtcggggttcaaatcccggacactccacttctccacattaaatatgtg |
33200135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 45416219 - 45416158
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | ||||||||||||||||||| || |||||||| | ||||||||||||||||| |
|
|
| T |
45416219 |
attgcataatttatgcaggggccggggttcgaatcccggacaccccacttctccacatttaa |
45416158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 47088831 - 47088900
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
||||||||| | || |||||||||||||| ||||||| ||||||||||||| |||||||| ||| ||||| |
|
|
| T |
47088831 |
tagggatatcgtattttatatgcaggggctggggttcgaaccccggacactccacttctcgacaattaaa |
47088900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 81 - 145
Target Start/End: Original strand, 50103892 - 50103957
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| |||||| ||||| | |||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
50103892 |
tgcataatatatgtaggggtcagggttcgaaccctggacacctcacttctccacatttaaaatgtg |
50103957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 88 - 121
Target Start/End: Complemental strand, 50859427 - 50859394
Alignment:
| Q |
88 |
tatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
50859427 |
tatatgcaggggccggggttcaaaccccggacac |
50859394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 160
Target Start/End: Original strand, 51942317 - 51942405
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
||||||||||||||||||||| || ||| |||||||| ||||||||||| | |||||||||||| || || |||| ||| |||| ||||| |
|
|
| T |
51942317 |
tagggatattgcatattatataca-gggtcggggttcgaaccccggacaccccacttctccacaatttaattgtgtgagctctagccact |
51942405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 1576184 - 1576148
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1576184 |
tattatatgcaggggccgggattcaaaccccggacac |
1576148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 79 - 140
Target Start/End: Original strand, 10632723 - 10632786
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca--ctcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||| | |||||||||| |||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
10632723 |
attgcataatttatgcaggggtcggggttcgaaccccggacacccccacttctccacatttaaa |
10632786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 75 - 134
Target Start/End: Original strand, 10851849 - 10851909
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| |||||| || ||| |||||||||||| |
|
|
| T |
10851849 |
ggatattgtatattatatgcaggggacggggttcgaaccccagaaactccacttctccaca |
10851909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 81 - 172
Target Start/End: Original strand, 12613208 - 12613300
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||| ||||| ||||||||| | || |||||||||||| | ||||||| |||||||||||||| ||| || || ||||||| |||||||| |
|
|
| T |
12613208 |
tgcataatatatacaggggccgagaatcgaaccccggacaccccacttctctacatttaaaatgtgtgagctccaatcactaggctgcttgac |
12613300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 15368837 - 15368873
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15368837 |
tattatatgcaggggccggggttcgaaccccggacac |
15368873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 17350093 - 17350129
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17350093 |
tattatatgcaggggccggggttcgaaccccggacac |
17350129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 23464049 - 23464013
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23464049 |
tattatatgcaggggccggggttcgaaccccggacac |
23464013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 28344898 - 28344989
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||| || ||||||||||| | |||||||||||| ||||| | || ||| |||| |||||||| |
|
|
| T |
28344898 |
tagggatattgcat-ttatatgtaggggtcggggatcgaaccccggacatcccacttctccacaattaaattatgtgagttctagccactagg |
28344989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 77 - 140
Target Start/End: Complemental strand, 30734493 - 30734429
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
||||||||||||||||||||||| | ||||| |||| |||||||| |||||||||||| ||||| |
|
|
| T |
30734493 |
atattgcatattatatgcaggggtccgggtttgaacctcggacactccacttctccacaattaaa |
30734429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 31401293 - 31401202
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||| |||||||| | |||||||| |||| ||||||||||||||||| | ||| |||||||| || || |||| ||| ||||||||||||| |
|
|
| T |
31401293 |
tagggacattgcataatttatgcaggagccgaggttcaaaccccggacaccccacgtctccacaatt-aactgtgtgagctctaaccactagg |
31401202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 41709971 - 41709879
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||| | ||||||||||||| | ||||| |||||| |||||| ||||||||| || ||||| |||| ||| |||| |||||||| |
|
|
| T |
41709971 |
tagggatattgcgtgttatatgcaggggtcaaggttcgaaccccagacactccacttctccgcaattaaattgtgtgagctctagccactagg |
41709879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 80 - 120
Target Start/End: Original strand, 42367742 - 42367782
Alignment:
| Q |
80 |
ttgcatattatatgcaggggccggggttcaaaccccggaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
42367742 |
ttgcatattatatgcaggggccggggttcgaatcccggaca |
42367782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 42831979 - 42832015
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42831979 |
tattatatgcaggggctggggttcaaaccccggacac |
42832015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 42946542 - 42946494
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
42946542 |
agggataatgcatattatatgcaggggctggggtttgaaccccggacac |
42946494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 43021670 - 43021602
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaa |
139 |
Q |
| |
|
|||||| | |||||||| |||||||||| |||||||| |||| ||||||| | |||||||||||||||| |
|
|
| T |
43021670 |
tagggacaatgcatattttatgcaggggtcggggttcgaacctcggacaccccacttctccacatttaa |
43021602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 47402711 - 47402675
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47402711 |
tagggatattgcatattatatgcagggtccggggttc |
47402675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 79 - 142
Target Start/End: Original strand, 52431853 - 52431916
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaat |
142 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
52431853 |
attgcataatatatgcagggaccggg-ttcaaaccccaaacacctcacttctccacatttaaaat |
52431916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 115
Target Start/End: Original strand, 621599 - 621642
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaacccc |
115 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
621599 |
tagggatattgcatattttatgcaggggtcggggttcgaacccc |
621642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 3560429 - 3560338
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| ||||||||||||||||| || |||| |||||| || ||| |||||||||||| || || |||| ||| |||| ||||||| |
|
|
| T |
3560429 |
tagggatattatatattatatgcaggggctggagttcgaaccccagatactccacttctccacaatttaattgtgtgagctctagccactag |
3560338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 162
Target Start/End: Complemental strand, 10052503 - 10052428
Alignment:
| Q |
88 |
tatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| | |||||||||||||| || | ||||||| || | ||||||| |
|
|
| T |
10052503 |
tatatgcaggggccgaggttcgaaccccggacaccccacttctccacattaaatacgtgcgagctccagccactag |
10052428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 87 - 145
Target Start/End: Complemental strand, 18893288 - 18893229
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||| ||||||||||| || |||||||||| |||||||||||| ||||| |||| |
|
|
| T |
18893288 |
ttatatgcagaggccggggttcgaatcccggacactccacttctccacaattaaattgtg |
18893229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 87 - 145
Target Start/End: Original strand, 18911888 - 18911947
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||| | |||||| ||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
18911888 |
ttatatgcaggggtcagggttcgaaccccggacaccccactcctccacatttaaaatgtg |
18911947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 19924453 - 19924536
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||| |||| ||||||||| | | |||||||| ||||||||||||| |||||||||| | ||||| |||| ||| |||| |
|
|
| T |
19924453 |
tagggatatcgcattttatatgcaagagtcggggttcgaaccccggacactccacttctccataattaaattgtgtgagttcta |
19924536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 84 - 162
Target Start/End: Complemental strand, 22592617 - 22592538
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||| | |||||||| ||| |||||||| | ||||||||| |||||| ||||| ||| |||||||||||| |
|
|
| T |
22592617 |
atattatatgcagagaccggggtttgaactccggacaccccacttctccatatttaatatgtgtgagttctaaccactag |
22592538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 171
Target Start/End: Complemental strand, 35121093 - 35120999
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
|||||||||||||| |||||||| |||||| |||||||||||| |||||||||| | ||||| |||| || |||||||||||| || ||||| |
|
|
| T |
35121093 |
gatattgcatattacatgcagggtttggggtttgaaccccggacacccacttctccaaaattaaattgtg-gaattctaaccactagattacttga |
35120999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 36726583 - 36726674
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| |||||| |||||||||||||| ||| ||||| || | |||| |||| ||||||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
36726583 |
taggaatattgtatattatatgcaggagccaaggttcgaatctcggatactccacttctccacaattaaattgtgtgagctctaaccactag |
36726674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 111
Target Start/End: Original strand, 46225409 - 46225448
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaa |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
46225409 |
tagggatattgcattttatatgcaggggtcggggttcaaa |
46225448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 158
Target Start/End: Complemental strand, 46867902 - 46867815
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||||||||||||| | | ||||||| ||| ||||| |||| ||| |||||||| |
|
|
| T |
46867902 |
tagggatattgcatattatatgcgggggttggagttcaaaccccggatatcaaacttctctacaattaaattgtgtgagctctaacca |
46867815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 85 - 120
Target Start/End: Complemental strand, 52833169 - 52833134
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggaca |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52833169 |
tattatatgcaggggccggggttcgaaccccggaca |
52833134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 85 - 123
Target Start/End: Original strand, 1660975 - 1661013
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1660975 |
tattatatgcaggggccggggttcgaaccccgaacactc |
1661013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 80 - 145
Target Start/End: Complemental strand, 3229754 - 3229688
Alignment:
| Q |
80 |
ttgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
3229754 |
ttgcataatatatgtaggggttggggttcaaaccccggacatcccacttctttacatttaaaatgtg |
3229688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 12650429 - 12650331
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||| |||||||||| || | | |||| ||| |||||||| | ||||||||||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
12650429 |
ggatattgcatgttatatgcagaggtcagagttcgaactccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
12650331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 121
Target Start/End: Complemental strand, 19976613 - 19976579
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
19976613 |
ttatatgcaggggccggggttcgaaccccggacac |
19976579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 73 - 123
Target Start/End: Complemental strand, 35195686 - 35195636
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||| |||||||||||||||||| || |||||| ||||||| |||||| |
|
|
| T |
35195686 |
agggataatgcatattatatgcagggaccagggttcgaaccccgtacactc |
35195636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 114
Target Start/End: Complemental strand, 47478896 - 47478854
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccc |
114 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
47478896 |
tagggatattgcatattatatgtagggatcggggttcaaaccc |
47478854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 121
Target Start/End: Complemental strand, 50199537 - 50199503
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
50199537 |
ttatatgcaggggccggggttcgaaccccggacac |
50199503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 51137806 - 51137895
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||| |||| ||| | |||||||||||||| |||| ||| | ||||| | ||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
51137806 |
tagggacattgtataatttatgcaggggccggagttcgaactctggacatcccacttctccacattt-aaatgtgcgagctccaaccacta |
51137895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 51933528 - 51933618
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||| || |||| | || ||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
51933528 |
tagggatattgcatattatatgcaggaatcggggttcgaactccagacattccatttctccacaattaaattgtgtgaggtctagccacta |
51933618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 4281405 - 4281505
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaa-atgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| | ||||||||||| || | |||| || |||||||||| |||||||||||||||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
4281405 |
tagggatattgtaaattatatgcagagggcatggttgaa-ccccggacacccacttctccacatttaaatgtgtgagagctctagccactaggctacttg |
4281503 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
4281504 |
ac |
4281505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 121
Target Start/End: Complemental strand, 10699227 - 10699182
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| || ||||||||| |
|
|
| T |
10699227 |
gatattacatattatatgtaggggccggggttcgaatcccggacac |
10699182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 13152933 - 13153002
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaa |
140 |
Q |
| |
|
||||||| ||||||| ||||| || ||| || |||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
13152933 |
tagggatgttgcataatatatacatgggttggagttcaatccccggacacctcacttctccacatttaaa |
13153002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 17580339 - 17580408
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||| |||||||||| | |||||||| ||| ||||||||| |||||||| ||| ||||| |
|
|
| T |
17580339 |
tagggatattgcatgttatatgcagaagtcggggttcgaactccggacactccacttctctacagttaaa |
17580408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 149
Target Start/End: Complemental strand, 21247783 - 21247714
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgag |
149 |
Q |
| |
|
||||| ||||||||||| |||||||| |||| ||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
21247783 |
tgcattttatatgcaggtttcggggttcgaacctcggacaccccacttctccatatttaaaatgtgcgag |
21247714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 23393670 - 23393739
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
||||||||| ||| ||||||||||||| || ||||| ||||||| ||||| |||||||||||| ||||| |
|
|
| T |
23393670 |
tagggatatcacattttatatgcaggggtcgaggttcgaaccccgaacactccacttctccacaattaaa |
23393739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 24253794 - 24253843
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| |||||| ||||| |
|
|
| T |
24253794 |
tagggatattgcatattatatgcaggggtcaaggttcgaaccccagacac |
24253843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 31124679 - 31124618
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | ||||||||||||||||||| ||| ||||| | | ||||||||||||||||| |
|
|
| T |
31124679 |
attgcataatttatgcaggggccggggttcgaactccggataccccacttctccacatttaa |
31124618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 121
Target Start/End: Original strand, 32660865 - 32660898
Alignment:
| Q |
88 |
tatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
32660865 |
tatatgcaggggctggggttcaaaccccggacac |
32660898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 172
Target Start/End: Original strand, 36754373 - 36754470
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||| ||||||||||||||||||| || ||| ||| | ||||| ||||||||| ||||||||| ||||| ||| |||||||| |||| | |||||| |
|
|
| T |
36754373 |
gatactgcatattatatgcaggggtcgatgtttaaattctggacacctcacttctacacatttaatatgtgtgagttctaaccattaggctacttgac |
36754470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 83 - 139
Target Start/End: Original strand, 50119005 - 50119062
Alignment:
| Q |
83 |
catattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||||| ||| |||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
50119005 |
catattttatgcaggggtcggagttcgaaccccggacaccccacttctccacatttaa |
50119062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 121
Target Start/End: Complemental strand, 2052741 - 2052709
Alignment:
| Q |
89 |
atatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
2052741 |
atatgcaggggccggggttcgaaccccggacac |
2052709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 3341799 - 3341763
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |
|
|
| T |
3341799 |
tattatatgcaggggccggggatcgaaccccggacac |
3341763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 14262796 - 14262748
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | |||||||||||| |||||||| |||||||||||| |
|
|
| T |
14262796 |
agggataatgcacaatatatgcaggggtcggggttcgaaccccggacac |
14262748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 16182841 - 16182877
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
16182841 |
tattatatgtaggggctggggttcaaaccccggacac |
16182877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 18607857 - 18607789
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||||||||| ||||||| ||||||| ||| | |||||||| |||||||| |
|
|
| T |
18607857 |
tagggacattgcataatttatgcaggggctggggttcgaaccccgaacaccccacttctctacatttaa |
18607789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 24134699 - 24134651
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
24134699 |
agggataatgcacaatatgtgcaggggccggggttcgaaccccggacac |
24134651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 24874993 - 24875061
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||| | |||||| |||| ||||||| |||| |||||| | |||||||||| |||||| |
|
|
| T |
24874993 |
tagggatattgcataatttatgcatgggcaggggttcgaacctcggacaccccacttctccatatttaa |
24875061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 140
Target Start/End: Complemental strand, 26909917 - 26909849
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaa |
140 |
Q |
| |
|
||||| |||||||| | ||||||| ||| ||||||| ||||| |||||| | ||||||||||||||||| |
|
|
| T |
26909917 |
agggacattgcataatttatgcagaggcgggggttcgaaccctggacaccccacttctccacatttaaa |
26909849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 113
Target Start/End: Complemental strand, 27398266 - 27398226
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaacc |
113 |
Q |
| |
|
||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
27398266 |
agggatattgcattttatatgtaggggtcggggttcaaacc |
27398226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 29491502 - 29491538
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
29491502 |
tattatatgcaggggtcggggttcgaaccccggacac |
29491538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 34562835 - 34562767
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||| |||| | ||| ||||||||| ||||| ||||||||||| | |||||||||| |||||| |
|
|
| T |
34562835 |
tagggatattacataatttatacaggggccgaggttcgaaccccggacaccccacttctccatatttaa |
34562767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 34702388 - 34702340
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
34702388 |
agggataatgcacaatatgtgcaggggccggggttcgaaccccggacac |
34702340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 38021284 - 38021320
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
38021284 |
tattatatgcaggggccggagttcgaaccccggacac |
38021320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 38032226 - 38032270
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccg |
116 |
Q |
| |
|
||||||||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
38032226 |
tagggatattgcatattgtatgcaggatctggggttcaaaccccg |
38032270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 39238748 - 39238784
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
39238748 |
tattatatgcaggggccgaggttcgaaccccggacac |
39238784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 40678855 - 40678891
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |
|
|
| T |
40678855 |
tattatatgcaggggccggggttcgatccccggacac |
40678891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 43109313 - 43109265
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
43109313 |
agggataatgcaaaatatgtgcaggggccggggttcgaaccccggacac |
43109265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 163
Target Start/End: Complemental strand, 46959729 - 46959689
Alignment:
| Q |
123 |
cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||||||||||| |
|
|
| T |
46959729 |
cacttctcctcatttaaaatgtgagagctctaaccactagg |
46959689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 135
Target Start/End: Original strand, 50536986 - 50537050
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacat |
135 |
Q |
| |
|
|||||||||||||||| ||||||||| | ||||||| |||| |||||| | ||||||||||||| |
|
|
| T |
50536986 |
tagggatattgcatataatatgcaggagttggggttcgaacctcggacaccccacttctccacat |
50537050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 87 - 119
Target Start/End: Complemental strand, 52961143 - 52961111
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggac |
119 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
52961143 |
ttatatgcaggggccggggttcgaaccccggac |
52961111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 9e-30; HSPs: 207)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 5328615 - 5328513
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||| ||| |||| |||||||| | |||| |
|
|
| T |
5328615 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaaatgtgtgagctctagccactaggctacttg |
5328516 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
5328515 |
acc |
5328513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 34413084 - 34413186
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
34413084 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
34413183 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
34413184 |
acc |
34413186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 2787129 - 2787027
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
2787129 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
2787030 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
2787029 |
acc |
2787027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 10736922 - 10736820
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
10736922 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
10736823 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
10736822 |
acc |
10736820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 11875908 - 11876010
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
11875908 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
11876007 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
11876008 |
acc |
11876010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 11890915 - 11891017
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
11890915 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
11891014 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
11891015 |
acc |
11891017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 29716882 - 29716984
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||| ||| | |||| |
|
|
| T |
29716882 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccacgaggctacttg |
29716981 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
29716982 |
acc |
29716984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 37717385 - 37717487
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
37717385 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
37717484 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
37717485 |
acc |
37717487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 94559 - 94458
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
94559 |
tagggatattgcatattatatgcaggagccggagttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
94460 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
94459 |
ac |
94458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 34894391 - 34894483
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
34894391 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacagttaaattgtgtgagctctagccactagg |
34894483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 43856430 - 43856338
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||| || || |||| ||| ||||||||||||| |
|
|
| T |
43856430 |
tagggatattgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgagagctctaaccactagg |
43856338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 2792801 - 2792892
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| || || |||| ||| || ||||||||| |
|
|
| T |
2792801 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctccaaccactag |
2792892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 1632488 - 1632386
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||| ||||||||||||||| | |||||||| |||||||||||||| ||||||||||| ||||| |||| ||| ||||||||||||||| |||| |
|
|
| T |
1632488 |
taggaatattacatattatatgcaggagtcggggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctaaccactaggttacttg |
1632389 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
1632388 |
acc |
1632386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 8953917 - 8953835
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||| ||||| |||| ||| |||| |
|
|
| T |
8953917 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactcacttctccacaattaaattgtgtgagctcta |
8953835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 17698544 - 17698646
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| || |||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
17698544 |
tagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
17698643 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
17698644 |
acc |
17698646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 23178939 - 23178837
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
23178939 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttcttcacaatttaattgtgtgagctctagccactaggctacttg |
23178840 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
23178839 |
acc |
23178837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 28909487 - 28909589
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
28909487 |
tagggatattgcatattacatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
28909586 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
28909587 |
acc |
28909589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 38219616 - 38219514
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
38219616 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
38219517 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
38219516 |
acc |
38219514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 75 - 163
Target Start/End: Complemental strand, 1337160 - 1337071
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
1337160 |
ggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagg |
1337071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 74 - 162
Target Start/End: Complemental strand, 6942577 - 6942488
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
6942577 |
gggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
6942488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 29514648 - 29514749
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| || ||||||||||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
29514648 |
tagggatattgtatattatatgcaggagctggggttcaaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
29514747 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
29514748 |
ac |
29514749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 31451005 - 31450904
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||| ||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
31451005 |
tagggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
31450906 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
31450905 |
ac |
31450904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 38955242 - 38955141
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||| ||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
38955242 |
tagggatattacatattatatgcaggggccggggttcgaaccccggacactcgacttctctacaattaaattgtgtgagctctatccactaggctacttg |
38955143 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
38955142 |
ac |
38955141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 37290944 - 37291036
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
37290944 |
tagggatattgcatattatatgcaggggccggcgttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactagg |
37291036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 43284014 - 43283923
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| || ||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
43284014 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactag |
43283923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 6659311 - 6659385
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
6659311 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
6659385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 6739713 - 6739787
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
6739713 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
6739787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 141
Target Start/End: Original strand, 7194284 - 7194354
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| |||||| |
|
|
| T |
7194284 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaaa |
7194354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 8265290 - 8265392
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| ||||||||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
8265290 |
tagggatattgcatattatatgcaggggtcagggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
8265389 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
8265390 |
acc |
8265392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 43186875 - 43186977
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || ||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
43186875 |
tagggatattgcatattatatgcaggagccaggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
43186974 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
43186975 |
acc |
43186977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 7816425 - 7816526
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| |||| |||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
7816425 |
tagggatattgaatattatatgcaggagccggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
7816524 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
7816525 |
ac |
7816526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 8034460 - 8034359
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| || |||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
8034460 |
tagggatattgcatattatatgcaggggccggggttcgaacaccagacaccccacttctccacaattaaattgtgtgagttctagccactaggctacttg |
8034361 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
8034360 |
ac |
8034359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 17072611 - 17072510
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||| ||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
17072611 |
taggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
17072512 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
17072511 |
ac |
17072510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 17575660 - 17575761
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||| ||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
17575660 |
taggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
17575759 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
17575760 |
ac |
17575761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 81 - 145
Target Start/End: Original strand, 33810671 - 33810736
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
33810671 |
tgcattttatatgcaggggccggggttcaaaccccggacaccccacttctccacatttaaaatgtg |
33810736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 41616414 - 41616314
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||| ||| |||||||||||| ||| |||||| ||| || | |||||||||| |||| |
|
|
| T |
41616414 |
tagggatattgtatattatatgcaggggccggggttcgaaccccggatactccacttctccaca-ttataatgtgtgagctccagccactaggttacttg |
41616316 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
41616315 |
ac |
41616314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 73 - 173
Target Start/End: Complemental strand, 43085270 - 43085169
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| ||||||||||||| |||||||||||| ||||| |||| || ||||||||||||| | ||||| |
|
|
| T |
43085270 |
agggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtaagctctaaccactaggctacttga |
43085171 |
T |
 |
| Q |
172 |
cc |
173 |
Q |
| |
|
|| |
|
|
| T |
43085170 |
cc |
43085169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 26567296 - 26567204
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| ||| |||||||||||||| | ||||||||| ||||| |||||||| |||| |||||||| |
|
|
| T |
26567296 |
tagggatattgcatattatatgcaggagtcgggattcgaaccccggacactcaatttctccacaattaaattgtgcgagctctagccactagg |
26567204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 21548546 - 21548443
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggcc-ggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgctt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| ||||||| ||| | |||||||||||| |||||||||| ||| |||| |||||||| | ||| |
|
|
| T |
21548546 |
tagggatattgcatattatatgccggggccgggggttcgaaccccgaacaccccacttctccacaattaaaatgtgtgagctctagccactaggctactt |
21548447 |
T |
 |
| Q |
170 |
gacc |
173 |
Q |
| |
|
|||| |
|
|
| T |
21548446 |
gacc |
21548443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 73 - 139
Target Start/End: Original strand, 24458340 - 24458407
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaa |
139 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
24458340 |
agggatattgtatattatatgcaggggccggggttcgaaccccggatactcaacttctccacatttaa |
24458407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 26022269 - 26022332
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
26022269 |
tagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccaca |
26022332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 37708722 - 37708805
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
37708722 |
tgcattttatatgcaggggccggggttcgaaccccggacatcccacttctccacatttaaaatgtgtgagctccagccactagg |
37708805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 38344071 - 38344162
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
38344071 |
tagggatattgcatattatatgcaggagctggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactag |
38344162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 42880970 - 42881053
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
42880970 |
tagggatattgcatattatatgtaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
42881053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 165
Target Start/End: Original strand, 133437 - 133531
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggtt |
165 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||| ||| ||||| ||||| |||||| ||||| |||| ||| ||||||||||||||| |
|
|
| T |
133437 |
tagggatattgcatattatatgcaggagtcggggttcgaactccgaacactccacttttccacagttaaattgtgggagttctaaccactaggtt |
133531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 257561 - 257663
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| |||| |||||||||||||||| ||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
257561 |
tagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
257660 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
257661 |
acc |
257663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 658359 - 658257
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| |||| |||||||||||||||| ||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
658359 |
tagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
658260 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
658259 |
acc |
658257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 844095 - 843993
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| |||| |||||||||||||||| ||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
844095 |
tagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
843996 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
843995 |
acc |
843993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 1937332 - 1937434
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||| ||||| |||||||| ||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
1937332 |
tagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctctacaattaaattgtgtgagctctagccactaggctacttg |
1937431 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
1937432 |
acc |
1937434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 11787176 - 11787274
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||| |||||||||| |||||||| ||||||||||||||||||| |||||||||||| ||||| | || ||| ||||||||||||| | |||||| |
|
|
| T |
11787176 |
ggatattacatattatatataggggccgtggttcaaaccccggacactccacttctccacaattaaattatgtgagctctaaccactaggctacttgac |
11787274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 13406622 - 13406712
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
13406622 |
tagggatattgcatattatatgcaggagccggagttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccacta |
13406712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 27077145 - 27077043
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || |||||||| | |||||||||||| ||||| |||| ||| || ||||| |||| | |||| |
|
|
| T |
27077145 |
tagggatattgcatattatatgcaggggtcggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagctcgaaccattaggctacttg |
27077046 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
27077045 |
acc |
27077043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 28420472 - 28420370
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||| ||||||||||||| ||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
28420472 |
taggaatattgcatattatatgctggagccggggttcgaaccccggacactccacttctccacgattaaattgtgtgagctctagccactaggctacttg |
28420373 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
28420372 |
acc |
28420370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 35939509 - 35939599
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| | |||||| ||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
35939509 |
tagggatattgcatattatatgcaggggccggggttcaaaccgtggacaccccacttcaccacaattaaattgtgtgagttctagccacta |
35939599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 6280502 - 6280603
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| ||||||||||||| |||||||||||| || || |||| ||| ||| |||||||| | |||| |
|
|
| T |
6280502 |
tagggatattgaatattatatgcaggagccggggttcgaaccccggacactccacttctccacagtttaattgtgtgagctctggccactaggctacttg |
6280601 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
6280602 |
ac |
6280603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 7797152 - 7797221
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
7797152 |
tagggatattgaatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaa |
7797221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 76 - 172
Target Start/End: Complemental strand, 10200725 - 10200628
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||| | ||||| |||| ||| | || |||||||| | |||||| |
|
|
| T |
10200725 |
gatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgagctatagccactaggctacttgac |
10200628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 14876650 - 14876549
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |||| |||||||| |||||||||||| | || |||| ||| ||||||||||||| | |||| |
|
|
| T |
14876650 |
tagggaaattgcatattatatgcaggagccggggttcgaacctcggacactccacttctccacaatataattgtgtgagctctaaccactaggctacttg |
14876551 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
14876550 |
ac |
14876549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 16449147 - 16449248
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
16449147 |
tagggatattgcatattatatgcaggggttggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
16449246 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
16449247 |
ac |
16449248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 22274659 - 22274559
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||| | |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
22274659 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacaccccacttctccacaatt-aattgtgtgagctctagccactaggctacttg |
22274561 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
22274560 |
ac |
22274559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 34266034 - 34266135
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| |||| |||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
34266034 |
tagggatattgcatattatatgcaggagttggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
34266133 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
34266134 |
ac |
34266135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 41458317 - 41458386
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||| |||| |||||||| |||||||||||||||||| |
|
|
| T |
41458317 |
tagggatattgcatattatatgcaggggctgggtttcgaacctcggacactccacttctccacatttaaa |
41458386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 5038580 - 5038672
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| || | |||||||| |
|
|
| T |
5038580 |
tagggatattgcatattatatgcaggagctggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctccagccactagg |
5038672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 159
Target Start/End: Original strand, 10573123 - 10573211
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||| ||||| |||||||||||| || || |||||||| |||| |||| |
|
|
| T |
10573123 |
tagggatattgcatattatatgcaggggttggggttcgaaccccgaacactccacttctccacaatttaattgtgcgagctctagccac |
10573211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 23858219 - 23858311
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||| ||||||| || ||||||||| || || |||| ||| |||| |||||||| |
|
|
| T |
23858219 |
tagggatattgcatattatatgcaggggccggagttcgaaccctggacactccaattctccacaatttaattgtgtgagttctagccactagg |
23858311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 29260641 - 29260733
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| || |||||||||||| ||||||||||||| ||||| |||| ||| |||| ||| |||| |
|
|
| T |
29260641 |
tagggatattgcatattatatgcaggagtcggggctcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccattagg |
29260733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 44444566 - 44444634
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||| | |||||||||||| |||| |
|
|
| T |
44444566 |
tagggatattgcatattatatgcaggggctggggttcgaaccccggacaccccacttctccacaattaa |
44444634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 75 - 161
Target Start/End: Complemental strand, 13749064 - 13748977
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||| | ||||| || || ||||||||||| ||| |||| |||||| |
|
|
| T |
13749064 |
ggatattgcatattatatgcagaggcaggggttcaaaccccggacaccccacttttctacgtttaaaatgtgtgagctctagccacta |
13748977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 23435281 - 23435218
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
23435281 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccaca |
23435218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 34472319 - 34472410
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| |||||| |||||| ||||| |||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
34472319 |
tagggatattgcatattatatgcaggagttggggttcgaaccccagacactccacttttccacaattaaattgtgtgagctctaaccactag |
34472410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 43980361 - 43980298
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
43980361 |
tagggatattgcatattatatgcagggatcggggttcgaaccccggacactcaacttctccaca |
43980298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 9370190 - 9370264
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| ||||||||||| ||||||| |||||| ||||| |||| |
|
|
| T |
9370190 |
tagggatattgcatattatatgcaggggtcagggttcgaaccccggacacctcacttatccacaattaaattgtg |
9370264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 10568107 - 10568209
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
10568107 |
tagggatattgcatattaaatgcaggggaaggggtttgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
10568206 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
10568207 |
acc |
10568209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 10594264 - 10594162
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| ||||||| ||||| |||||||||||| ||||| | || || |||| |||||| ||| |||| |
|
|
| T |
10594264 |
tagggatattgcattttatatgcaggagccggggttcgaaccccgtacactccacttctccacaattaaattatgtcagctctagccactaagttacttg |
10594165 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
10594164 |
acc |
10594162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 38620389 - 38620287
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| ||| ||||||| ||||| |||||||||||| ||||| |||| || |||| |||||||| | |||| |
|
|
| T |
38620389 |
tagggatattgtatattatatgcaggagccgggattcgaaccccgaacactccacttctccacaattaaattgtgtgaactctagccactaggctacttg |
38620290 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
38620289 |
acc |
38620287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 159
Target Start/End: Original strand, 8969117 - 8969206
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaa-tgtgcgagatctaaccac |
159 |
Q |
| |
|
|||| ||||||||||||||||||||| || ||||||| |||| |||||||| |||||||||||| |||||| |||| ||| ||||||||| |
|
|
| T |
8969117 |
taggaatattgcatattatatgcaggagctggggttcgaacctcggacactccacttctccacaattaaaattgtgtgagctctaaccac |
8969206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 16432176 - 16432075
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||| |||||||| |||||||||| | || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
16432176 |
tagggatattgcatattatatgcaggagccggggttcgaacatcggacactccacttctccataatttaattgtgtgagctctagccactaggctacttg |
16432077 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
16432076 |
ac |
16432075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 17027928 - 17027828
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| || |||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
17027928 |
tagggatattgcatattatatgccggagccggggttcgaa-cccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
17027830 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
17027829 |
ac |
17027828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 17558364 - 17558264
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| || |||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
17558364 |
tagggatattgcatattatatgccggagccggggttcgaa-cccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
17558266 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
17558265 |
ac |
17558264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 29499600 - 29499673
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||| ||||||| |||| | ||||||| ||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
29499600 |
tagggatattgcatgttatatgtagggtcgggggttcgaactccggatacccacttctccacatttaaaatgtg |
29499673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 34158705 - 34158604
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||| | ||| |||||||||||| ||||| |||| ||| |||| | |||||| | |||| |
|
|
| T |
34158705 |
tagggatattgcatattatatgcaggaggcggggttcgaaccccgcatactccacttctccacaattaaattgtgtgagctctagctactaggctacttg |
34158606 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
34158605 |
ac |
34158604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 132
Target Start/End: Original strand, 40362070 - 40362131
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctcca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| |||||||| |||||||||| |
|
|
| T |
40362070 |
tagggatattgcatattatatgcaggggtcggggttcgaacctcggacactccacttctcca |
40362131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 12770390 - 12770458
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
12770390 |
tagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaa |
12770458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 76 - 135
Target Start/End: Complemental strand, 13773436 - 13773376
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacat |
135 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
13773436 |
gatattgcatattatatgtaggagccggggttcgaaccccggacacttcacttctccacat |
13773376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 81 - 172
Target Start/End: Original strand, 30300360 - 30300452
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||| || | ||||||||| |||||||||||| ||| || || |||| |||| |||||| |
|
|
| T |
30300360 |
tgcataatatatgcaggggccggggttcgaaccccggaaaccctacttctccatatttaaaatgtgtgagctccaaacactgggttacttgac |
30300452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 73 - 172
Target Start/End: Original strand, 31712572 - 31712671
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
|||||||||| |||||||||| ||||||| |||||| ||||||||||| | ||||||||||||||| | ||||| ||| |||| |||||||| | ||||| |
|
|
| T |
31712572 |
agggatattgtatattatatgtaggggccagggttcgaaccccggacaccccacttctccacattt-atatgtgtgagctctagccactaggctacttga |
31712670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 32719655 - 32719564
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| || |||||||||| ||||| |||||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
32719655 |
tagggatattgcatattatatgca-gggttggggttcgaatcccggacactccacttttccacaattaaattgtgtgagctctaaccactagg |
32719564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 84 - 162
Target Start/End: Original strand, 5332950 - 5333029
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
5332950 |
atattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
5333029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 158
Target Start/End: Original strand, 7453374 - 7453461
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| ||||||||||| | |||||||||| | ||||| |||| || |||||||| |
|
|
| T |
7453374 |
tagggatattgcattttatatgtaggggccggggttcgaaccccggacaccccacttctccataattaaattgtgtgaactctaacca |
7453461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 138
Target Start/End: Original strand, 10083185 - 10083252
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacattta |
138 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| ||||||||||| | |||||||||| ||||| |
|
|
| T |
10083185 |
tagggatattgcatattatatgcaggggtcgaggttcgaaccccggacaccccacttctccatattta |
10083252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 162
Target Start/End: Complemental strand, 13647501 - 13647414
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||| | || ||||| ||||||||||||| |||||||||||| || || |||| ||| |||| ||||||| |
|
|
| T |
13647501 |
gatattgcatattatatgcaggagtcgtggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactag |
13647414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 162
Target Start/End: Complemental strand, 13747926 - 13747839
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||| | || ||||| ||||||||||||| |||||||||||| || || |||| ||| |||| ||||||| |
|
|
| T |
13747926 |
gatattgcatattatatgcaggagtcgtggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactag |
13747839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 18926183 - 18926100
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||| ||| |||||||||||| ||||||||||||| ||||| |||| ||| |||| |
|
|
| T |
18926183 |
tagggatatcgcattttatatgcaggggcagggattcgaaccccggacacttcacttctccacaattaaattgtgtgagctcta |
18926100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 23261323 - 23261406
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||| |||| | |||||||||| ||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
23261323 |
tagggatatcgcatttcatatgcagggaccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
23261406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 26192764 - 26192674
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||| ||||||||||| | |||||||||| | |||||||||| || |||| ||||||| |
|
|
| T |
26192764 |
tagggatattgcatattatatgcagaggtcggggttcgaaccccggacaccccacttctccata-ttaaaatgtgtgaactctagccactag |
26192674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 36035218 - 36035135
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| ||||||||||||| |||||||| |||| ||||||| | |||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
36035218 |
tgcattttatatgcaggggtcggggttcgaacctcggacaccccacttctccacatttaaaatgtgtgagctccagccactagg |
36035135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 43656058 - 43656149
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |||| |||||| | |||||||||||| || || |||| ||| |||| ||||||| |
|
|
| T |
43656058 |
tagggatattgcatattatatgtaggggtcggggttcgaacctcggacattccacttctccacaatttaattgtgtgagctctagccactag |
43656149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 7763983 - 7763897
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||| ||||||| | |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
7763983 |
gatattgcatattatatgcaggggccgggatttgaactccggacaccccacttctccacaattaaattgtgtgagctctagccacta |
7763897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 7765668 - 7765766
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| |||||| |||||| || ||||||||| ||||| |||| ||| | |||||| |||| | |||||| |
|
|
| T |
7765668 |
ggatattacatattatatgcaggagccggggttcgaaccccagacactccatttctccacaattaaattgtgtgagctttaaccaataggctacttgac |
7765766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 9187271 - 9187169
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||| ||| |||||||| |||| |||||||| |||||| |||||| ||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
9187271 |
tagggatattacattttatatgctggggtcggggttcgaacccccaacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
9187172 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
9187171 |
acc |
9187169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 29734050 - 29733952
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||| ||||||||| ||| |||||||| ||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
29734050 |
ggatattgtatattatatgcaggagtcggggttcgaaccccggatactccacttctctacaattaaattgtgtgagctctagccactaggctacttgac |
29733952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 81 - 162
Target Start/End: Original strand, 34873117 - 34873199
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||| ||||||||||||| |||||||| |||| |||||| | ||||||||||||||||||||||| ||| || | ||||||| |
|
|
| T |
34873117 |
tgcattttatatgcaggggtcggggttcgaacctcggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
34873199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 173
Target Start/End: Original strand, 39587573 - 39587671
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||| |||||| |||||| |||| ||| ||||| |||||||| ||||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
39587573 |
gatattgcattttatattcaggggtcgggattcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
39587671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 70 - 173
Target Start/End: Complemental strand, 4654160 - 4654055
Alignment:
| Q |
70 |
gctagggatattgcatattatatgcaggggccggggttcaaacccc-ggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgc |
167 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||| |||||| ||||||| |||||||||||| || || |||| ||| |||| ||||| | || | |
|
|
| T |
4654160 |
gctagggatattgcatattatatgcaagggccaaggttcgaacccctggacactccacttctccacaatttaattgtgtgagctctagccactggattac |
4654061 |
T |
 |
| Q |
168 |
ttgacc |
173 |
Q |
| |
|
|||||| |
|
|
| T |
4654060 |
ttgacc |
4654055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 74 - 162
Target Start/End: Original strand, 5570918 - 5571007
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||| ||||||||||||| ||| |||| ||||||||||| | |||||||||||| ||||| | || ||| |||| ||||||| |
|
|
| T |
5570918 |
gggatattgcatgttatatgcaggggtcggagttcgaaccccggacaccccacttctccacaattaaattatgtgagctctagccactag |
5571007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 81 - 145
Target Start/End: Original strand, 8183351 - 8183416
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggac-actcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||| ||| || |||||||||| |||||||||||| |
|
|
| T |
8183351 |
tgcattttatatgcaggggccggggttcgaaccccagacaacccacttctccatatttaaaatgtg |
8183416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 76 - 172
Target Start/End: Original strand, 10030438 - 10030535
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||| | ||||| |||||||||||| | || |||| ||| |||| |||||||| | |||||| |
|
|
| T |
10030438 |
gatattgcatattatatgcaggtgccggggttcgaaccctgaacactccacttctccacaagttaactgtgtgagttctagccactaggctacttgac |
10030535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 87 - 163
Target Start/End: Original strand, 31024331 - 31024408
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||| | |||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
31024331 |
ttatacgcaggggctggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactagg |
31024408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 481033 - 481101
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||||||||||| ||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
481033 |
tagggacattgcataatttatgcaggggccgcggttcgaaccccggacaccccacttctccacatttaa |
481101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 2908139 - 2908048
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||| | |||||| ||||||||||||||||||||| ||||| ||||| | ||||||||| || |||||||||| ||| |||| |||||||| |
|
|
| T |
2908139 |
tagggacaatgcataatatatgcaggggccggggttcgaaccctggacaccccacttctccgca-ttaaaatgtgtgagctctagccactagg |
2908048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 3912212 - 3912120
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| |||| || || |||||| | ||||||||||||||| |||||| ||| |||| |||||||| |
|
|
| T |
3912212 |
taggaatattgcatattatatgcagaggccgaggtttgaatcctggacaccccacttctccacatttataatgtgtgagctctagccactagg |
3912120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 159
Target Start/End: Original strand, 7388477 - 7388565
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||| ||||| || ||||||||| || || |||| ||| |||| |||| |
|
|
| T |
7388477 |
tagggatattgcatattatatgcaggggttggggttcaaactccgaacactccatttctccacaatttaattgtgtgagctctagccac |
7388565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 70 - 145
Target Start/End: Complemental strand, 11406729 - 11406653
Alignment:
| Q |
70 |
gctagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| ||||||||||||||||| |||| | ||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
11406729 |
gctaggaatattgcatattatatgtgggggtcaaggttcgaaccctggacacctcacttctccacatttaaaatgtg |
11406653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 13450474 - 13450561
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||| |||||| |||||| |||||||||||| ||||| || | ||| |||||||||||| |
|
|
| T |
13450474 |
ggatattacatattatatgcagaggccagggttcgaaccccagacactccacttctccacaattaaattg-gtgagctctaaccactag |
13450561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 15856554 - 15856463
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||| |||||||| | ||| ||||| |||||||||||||| |||||| | ||||||||||||||| || |||| ||| ||||||||||||| |
|
|
| T |
15856554 |
tagggacattgcataatttatacagggaccggggttcaaacctcggacaccccacttctccacattt-aattgtgtgagctctaaccactagg |
15856463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 171
Target Start/End: Complemental strand, 33473403 - 33473303
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| ||| |||||||||||| |||||||| || ||||||||| |||||||| |||| ||||| |||| ||| |||| |||||||||| |||| |
|
|
| T |
33473403 |
tagggatatcacattttatatgcagggatcggggttcgaatcccggacacttcacttcttcacaattaaattgtgtgagctctagccactaggttacttg |
33473304 |
T |
 |
| Q |
171 |
a |
171 |
Q |
| |
|
| |
|
|
| T |
33473303 |
a |
33473303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 120
Target Start/End: Original strand, 37838599 - 37838647
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
37838599 |
tagggatattgcatattatatgcaggggccagagttcgaaccccggaca |
37838647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 76 - 162
Target Start/End: Complemental strand, 5326214 - 5326127
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| |||||||||| |||||| |||| ||||||||||||| |||||||||| | ||||| |||| || |||| ||||||| |
|
|
| T |
5326214 |
gatattgcattttatatgcagaggccggtgttcgaaccccggacactccacttctccataattaaattgtgtgaactctagccactag |
5326127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 138
Target Start/End: Original strand, 5683776 - 5683843
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacattta |
138 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| |||||| ||||| | ||||||||||||||| |
|
|
| T |
5683776 |
taggaatattgcatattatatgcaggggttggggttcgaaccccagacaccctacttctccacattta |
5683843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 8862174 - 8862123
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| ||| |||||||||| |
|
|
| T |
8862174 |
tagggatattgcatattatatgcaggggtcagggttcgaactccggacactc |
8862123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 11289471 - 11289380
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||||||| ||||| ||||| | |||||||||||| ||||| | || || |||||||||||| |
|
|
| T |
11289471 |
tagggatattgcattttatatgtaggggctggggttcgaaccctggacattccacttctccacaattaaattatgtcagctctaaccactag |
11289380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 26280832 - 26280769
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
26280832 |
tagggatattgcattttatatgccggagccggggttcgaaccccgaacactccacttctccaca |
26280769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 30972865 - 30972783
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||||||||||||| || ||| |||||| || |||||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
30972865 |
tagggatattgcatattatatgccggagcc-gggttcgaatcccggacactccacttctccacaattaaattgtgtgagctcta |
30972783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 37535547 - 37535456
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||| | | |||||| ||||||||||||| || ||||||||| || || |||| || |||||||||||| |
|
|
| T |
37535547 |
tagggatattgcatattatatgcagaagtcagggttcgaaccccggacactccatttctccacaatttaattgtgtgaactctaaccactag |
37535456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 74 - 172
Target Start/End: Original strand, 38774095 - 38774194
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||| |||||||| |||||||||||| ||||| ||| ||| |||| |||||||| | |||||| |
|
|
| T |
38774095 |
gggatattgcattttatatgcagggatcggggttcgaacttcggacactccacttctccacaattaaatcgtgtgagctctagccactaggctacttgac |
38774194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 76 - 134
Target Start/End: Original strand, 42035362 - 42035421
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccaca |
134 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
42035362 |
gatattgtatattatatgcaggggctggggttcgaaccccagacactctacttctccaca |
42035421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 44673696 - 44673605
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||| ||| ||||||||||||| |||||||| |||||| |||||| ||||| |||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
44673696 |
tagggatatcacattttatatgcaggggtcggggttcgaaccccagacactccacttttccacaattaaattgtgtgagctctagccactag |
44673605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 12273 - 12199
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| | || ||| ||||| |||||| |||||||||||| ||||| |||| |
|
|
| T |
12273 |
tagggatattgcatattatatgcaggggtcaggtttctaacccatgacactacacttctccacaattaaattgtg |
12199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 13059225 - 13059151
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| | |||||| | ||||||||||| ||||||| |||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
13059225 |
tagggacaatgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctccacatttaaaatgtg |
13059151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 13105113 - 13105187
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| | |||||| |||||||| |||||||||||| |||| | ||||| | |||||||||||||||||||||| |
|
|
| T |
13105113 |
tagggacaatgcataatatatgcaagggccggggttcgaacctcagacaccccacttctccacatttaaaatgtg |
13105187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 74 - 163
Target Start/End: Complemental strand, 31153065 - 31152975
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||| ||||| ||||| | |||||||||||| ||||| |||| ||| |||| ||| |||| |
|
|
| T |
31153065 |
gggatattgcatattatatgtaggggtcagggttcgaaccctggacaccccacttctccacaattaaattgtgtgagctctagccattagg |
31152975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 32258029 - 32258119
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||| ||||| |||| || ||||| || || |||||| | ||||||||||| ||||| |||| ||| ||||||||||| |
|
|
| T |
32258029 |
tagggatattgcatattctatgcgggggtcgaggttcgaatcctggacaccccacttctccacaattaaattgtgtgagctctaaccacta |
32258119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 118
Target Start/End: Original strand, 33617994 - 33618040
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
33617994 |
tagggatattgcatattatatgcaggggtcggtgttcgaaccccgga |
33618040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 76 - 145
Target Start/End: Original strand, 34760993 - 34761063
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| |||||||||||||||| |||| |||| ||||||||||| | |||||| ||| |||||||||||| |
|
|
| T |
34760993 |
gatatttcatattatatgcagggaccggagttcgaaccccggacaccccacttcaccatatttaaaatgtg |
34761063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 36540309 - 36540383
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |||||| ||||| |||||||||| | ||||| |||| |
|
|
| T |
36540309 |
tagggatattgcattttatatgcaggggtcggggttcgaaccccaaacactccacttctccataattaaattgtg |
36540383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 37669708 - 37669782
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||| |||||||||| ||| || |||| |||||| |||||| |||||||||||| ||||| |||| |
|
|
| T |
37669708 |
tagggatattgcattttatatgcagtggctggagttcgaaccccagacactccacttctccacaattaaattgtg |
37669782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 118
Target Start/End: Original strand, 38402273 - 38402319
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccgga |
118 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
38402273 |
tagggatattgcatattatttgcaggggttggggttcaaaccccgga |
38402319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 40740547 - 40740620
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| || | || |||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
40740547 |
tagggatattgcatattatatgcagggg-cgtaggtcgaacctcggacaccccacttctccacatttaaaatgtg |
40740620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 44340393 - 44340319
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||| |||| | |||| ||| ||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
44340393 |
tagggatattgcatattataaacaggagtcgggattcgaaccccggacactccacttctccacaattaaattgtg |
44340319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 2294147 - 2294098
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
2294147 |
tagggatattacatattatatgcaggggtcggggttcgaaccccagacac |
2294098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 8698628 - 8698559
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| || |||||||| | ||||||| |||||||||| |
|
|
| T |
8698628 |
tagggatattgcatattatatgtaggggttggggttcgaatcccggacaccccacttcttcacatttaaa |
8698559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 9070773 - 9070672
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| |||| ||||||| ||||| | |||||| |||| ||||||||| |||| |||||| ||||| ||| ||| ||||||||||||| | |||| |
|
|
| T |
9070773 |
tagggatatcgcattttatatgtaggggtcagggttcgaacctcggacactccacttttccacaattaaattgtatgagctctaaccactaggctacttg |
9070674 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
9070673 |
ac |
9070672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 75 - 163
Target Start/End: Original strand, 10761844 - 10761933
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||| || |||||| |||| ||||| ||||| ||||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
10761844 |
ggatattgcatattatatttagaggccggagttcgaaccctagacacctcacttctccacaattaaattgtgtgagctctagccactagg |
10761933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 11127925 - 11128025
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| |||||||||||||||| |||| || |||||| ||||||||||||| ||||| |||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
11127925 |
taggaatattgcatattatatacaggatcc-gggttcgaaccccggacactccacttttccacaattaaattgtgtgagctctagccactaggctacttg |
11128023 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
11128024 |
ac |
11128025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 11483142 - 11483210
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||| ||||||||||||||||||||| | |||||||| |||| |||||||| |||||||||||| ||||| |
|
|
| T |
11483142 |
taggaatattgcatattatatgcaggag-cggggttcgaacctcggacactccacttctccacaattaaa |
11483210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 76 - 140
Target Start/End: Original strand, 11872092 - 11872157
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| ||||||| ||||| |||||||||||| ||||| |
|
|
| T |
11872092 |
gatattacattttatatgcaggggccggggtttgaaccccgaacactccacttctccacaattaaa |
11872157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 20540154 - 20540105
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| || |||||||| |
|
|
| T |
20540154 |
tagggatattgcatattatatgcaggggctggggttcgaattccggacac |
20540105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 33838346 - 33838447
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||| ||| || |||||| || ||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
33838346 |
tagggatattgcaaattatatgtagaagccggggttcgaactccagacactccatttctccacaattaaattgtgtgagctctagccactaggctacttg |
33838445 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
33838446 |
ac |
33838447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 35880862 - 35880935
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||||||| ||| ||| | ||||||| |||||||||||| |
|
|
| T |
35880862 |
tagggatattgtatattatatgtaggggttggggttcaaaccacgggcacccgtttctccatatttaaaatgtg |
35880935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 89 - 149
Target Start/End: Complemental strand, 38107505 - 38107444
Alignment:
| Q |
89 |
atatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgag |
149 |
Q |
| |
|
|||||||||||||||||||| |||||| |||| | |||||||||||| ||||| |||||||| |
|
|
| T |
38107505 |
atatgcaggggccggggttcgaaccccagacaccccacttctccacaattaaattgtgcgag |
38107444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 44553614 - 44553683
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||| ||| ||||| ||||||||||||| ||| |||||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
44553614 |
taggtataatgcatgttatatgcaggggtcggagttcaaaccccgaacactccacttctccacacttaaa |
44553683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 2696565 - 2696601
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2696565 |
tattatatgcaggggccggggttcgaaccccggacac |
2696601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 2800051 - 2800087
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2800051 |
tattatatgcaggggccggggttcgaaccccggacac |
2800087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 3189997 - 3189948
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
3189997 |
tagggatattgcatattatatgca--ggtcggggttcgaaccccggacactc |
3189948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 4798604 - 4798568
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4798604 |
tattatatgcaggggccggggttcgaaccccggacac |
4798568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 11231443 - 11231491
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
11231443 |
agggacattgcataatttatgcaggggccggggttcgaaccccggacac |
11231491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 12273725 - 12273633
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||| |||||||||||||||| ||||| | ||||||| ||||| |||||| ||| || |||||| || || |||| ||| ||||||||||||| |
|
|
| T |
12273725 |
taggaatattgcatattatatacagggactggggttcgaaccctggacacttcatttatccacaatttaattgtgtgagttctaaccactagg |
12273633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 15042428 - 15042392
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15042428 |
tattatatgcaggggccggggttcgaaccccggacac |
15042392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 17980314 - 17980350
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17980314 |
tattatatgcaggggccggggttcgaaccccggacac |
17980350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 19957396 - 19957348
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| ||||||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
19957396 |
agggataatgcatattatatgcaggggacgaggttcgaaccccggacac |
19957348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 24296916 - 24296829
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||| ||| | |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
24296916 |
tagggatattgcatattatatgcaggggttggggttcgaaccc---acaccccacttctccacaattaaattgtgtgagttctagccacta |
24296829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 25890452 - 25890384
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | |||||| |||||||||||| ||||||||||| | |||||||||||| |||| |
|
|
| T |
25890452 |
tagggacattgcataatttatgcaagggccggggttcgaaccccggacaccccacttctccacaattaa |
25890384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 38745327 - 38745235
Alignment:
| Q |
72 |
tagggatattgcata-ttatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||| ||||||||| ||||| |||||| ||||| ||||| | |||||||||||| ||||| |||| || |||| ||||||| |
|
|
| T |
38745327 |
tagggatattgcatatttatatgcatgggccagggttcgaacccaggacaccccacttctccacaattaaattgtgtgatttctagccactag |
38745235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 102 - 149
Target Start/End: Original strand, 40904583 - 40904631
Alignment:
| Q |
102 |
ggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgag |
149 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40904583 |
ggggttcgaacctcggacacctcacttctccacatttaaaatgtgcgag |
40904631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 42006800 - 42006892
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| ||||| | | ||| |||||||||||| || || |||| ||| | || |||||||| |
|
|
| T |
42006800 |
tagggatattgcatattatatgcaggagccgtggttcgaaccctgaatactccacttctccacaatttaattgtgtgagttttagccactagg |
42006892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 84 - 162
Target Start/End: Complemental strand, 9813077 - 9812998
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||| || ||| |||| || | | ||||| ||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
9813077 |
atattatatgcagaggtcggagttcgaatctcagacacctcacttctccacatttaaaatgtatgagttctaaccactag |
9812998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 162
Target Start/End: Complemental strand, 24480865 - 24480778
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||| |||| ||||| | |||||||||||| ||||| | || ||| |||| ||||||| |
|
|
| T |
24480865 |
gatattgtatattatatgcaggggctggggttcgaaccttggacaccccacttctccacaattaaattatgtgagctctagccactag |
24480778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 154
Target Start/End: Complemental strand, 37524251 - 37524172
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||| | ||||| |||||||||| | ||||| |||| ||| |||| |
|
|
| T |
37524251 |
gatattgcatattatatgcagaggccgaggttcaaacctcatacactccacttctccataattaaattgtgtgagctcta |
37524172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 39362287 - 39362378
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatt-taaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||| || || |||| |||||| |||| | |||||||||||||| |||||||| ||| |||| |||||| |
|
|
| T |
39362287 |
tagggatattgcatattatatgcagaggttggagttcgaaccccagacaccccacttctccacattaaaaaatgtgtgagttctagccacta |
39362378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 42511631 - 42511548
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||||| ||||||| ||| | || ||||||||||||| |||||| ||| |||| |
|
|
| T |
42511631 |
taggaatattacatattatatgcaggggtcggggtttgaaccccgaacaccccatttctccacatttataatgtgtgagttcta |
42511548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 84 - 162
Target Start/End: Complemental strand, 42801685 - 42801606
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| ||||| |||||||| |||| ||||||| | ||||||||| | ||||| |||| ||| |||||||||||| |
|
|
| T |
42801685 |
atattatatgtaggggtcggggttcgaacctcggacaccccacttctccataattaaattgtgtgagttctaaccactag |
42801606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 158
Target Start/End: Complemental strand, 43053933 - 43053846
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||||| || |||||||| |||||||||||| ||||| |||| ||| | |||||| |
|
|
| T |
43053933 |
tagggatatttcatattatatgcaggagtcggggttcgaatttcggacactccacttctccacaattaaattgtgtgagctataacca |
43053846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 4615724 - 4615650
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||| |||| |||||||| ||||||| |||| ||||| |||| |
|
|
| T |
4615724 |
tagggatattgcatattatatgcaggagcttgggtttgaacctcggacactccacttcttcacaattaaattgtg |
4615650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 9407413 - 9407502
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||| ||| || ||||| ||||| | |||| ||||||||||||| || || |||| ||| |||| |||||| |
|
|
| T |
9407413 |
tagggatattgcatattatatgca-gggtcgaggttcgaacccagaacacttcacttctccacaatttaattgtgtgagctctagccacta |
9407502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 76 - 145
Target Start/End: Complemental strand, 23339940 - 23339870
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| ||||| ||||| | ||||||| |||| ||||| |||| |
|
|
| T |
23339940 |
gatattgtatattatatgtaggggccggggttcgaaccctggacaccccacttcttcacaattaaattgtg |
23339870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 139
Target Start/End: Complemental strand, 34812557 - 34812507
Alignment:
| Q |
90 |
tatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
34812557 |
tatgcaggggctggggttcgaaccccggacaccccacttctccacatttaa |
34812507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 37090661 - 37090560
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||| |||||| ||||| ||| |||||||| ||||| | || ||| |||| |||||||| | |||| |
|
|
| T |
37090661 |
tagggatattgtatattatatgcaggagtcggggttcgaacccc-aacactccacatctccacaattaaattatgtgagctctagccactaggctacttg |
37090563 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
37090562 |
acc |
37090560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 139
Target Start/End: Original strand, 38283164 - 38283214
Alignment:
| Q |
90 |
tatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||||||| |||||| |||| | ||||||||||||||||| |
|
|
| T |
38283164 |
tatgcaggggccggggttcgaaccccagacaccccacttctccacatttaa |
38283214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 88 - 138
Target Start/End: Complemental strand, 45281362 - 45281313
Alignment:
| Q |
88 |
tatatgcaggggccggggttcaaaccccggacactcacttctccacattta |
138 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
45281362 |
tatatgcaggggttggggttcgaaccccggacac-cacttctccacattta |
45281313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 141
Target Start/End: Complemental strand, 11537470 - 11537405
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaa |
141 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||| |||||||||||| | ||||||||| | |||||| |
|
|
| T |
11537470 |
atattacatattatatgcaggagcccgggttcgaaccccggacaccctacttctccataattaaaa |
11537405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 18942937 - 18942986
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||| |||||| |||||||| || ||||| |||||||||||||||| |
|
|
| T |
18942937 |
tagggataatgcataatatatgcatggtccgggtttcaaaccccggacac |
18942986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 94 - 162
Target Start/End: Original strand, 21133051 - 21133120
Alignment:
| Q |
94 |
caggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||| |||||| |||| | |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
21133051 |
caggggccggggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctagccactag |
21133120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 31260986 - 31260925
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | ||||||||||||||| ||||||||||| | | ||||||||||||| ||||| |
|
|
| T |
31260986 |
attgcataatttatgcaggggccgggattcaaaccccgaatacctcacttctccacgtttaa |
31260925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 74 - 123
Target Start/End: Original strand, 40298716 - 40298765
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||| || ||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
40298716 |
gggatattgtattttatatgcaagggtcggggttcgaaccccggacactc |
40298765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 41272116 - 41272185
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaa |
140 |
Q |
| |
|
|||||| |||||||| | ||||||||||| ||||||| ||| | |||||| |||||||||||||||||| |
|
|
| T |
41272116 |
tagggacattgcataatttatgcaggggctggggttcgaactctggacacaccacttctccacatttaaa |
41272185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 101
Target Start/End: Original strand, 41689904 - 41689933
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggcc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41689904 |
tagggatattgcatattatatgcaggggcc |
41689933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 43875245 - 43875208
Alignment:
| Q |
124 |
acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
43875245 |
acttctccacatttaaaatgtgcgagctctagccacta |
43875208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 87 - 127
Target Start/End: Original strand, 574259 - 574299
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacactcactt |
127 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| ||||| |
|
|
| T |
574259 |
ttatatgcaggggtcggggttcgaaccccggacacccactt |
574299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 1503933 - 1503980
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
1503933 |
agggatattg-atattatatgcaggagccggggttcgaaccccagacac |
1503980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 1588799 - 1588835
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
1588799 |
tattatatgcaggggccggggttcgaacctcggacac |
1588835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 7314765 - 7314801
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
7314765 |
tattatatgcaggggccgaggttcgaaccccggacac |
7314801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 9524989 - 9525025
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
9524989 |
tattatatgcaggggccggggttcgaaccccagacac |
9525025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 10970298 - 10970334
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
10970298 |
tattatatgcaggggctggggttcaaaccccgaacac |
10970334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 132
Target Start/End: Original strand, 13074640 - 13074696
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctcca |
132 |
Q |
| |
|
|||||||||||||||||| | ||| |||||| |||||||||||| |||||||||| |
|
|
| T |
13074640 |
gatattgcatattatatgtaagggttggggtttgaaccccggacacccacttctcca |
13074696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 17987512 - 17987476
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
17987512 |
tattatatgcaggggccggagttcgaaccccggacac |
17987476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 18144744 - 18144708
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
18144744 |
tagggatattgcattttatatgcagggtccggggttc |
18144708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 24608546 - 24608510
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
24608546 |
tattatatgcaggggccggggttcgaaccccagacac |
24608510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 81 - 121
Target Start/End: Complemental strand, 30176452 - 30176412
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
30176452 |
tgcataatatatgcaaggtccggggttcaaaccccggacac |
30176412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 30942662 - 30942626
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
30942662 |
tattatatgcaggggccggggttcgaaccccgaacac |
30942626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 31406787 - 31406847
Alignment:
| Q |
80 |
ttgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||| | ||||||||||||||||||| |||| |||| | | ||||||||||||||||| |
|
|
| T |
31406787 |
ttgcataatttatgcaggggccggggttcgaacctcggataccacacttctccacatttaa |
31406847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 37092113 - 37092157
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccg |
116 |
Q |
| |
|
||||||||||| ||||||||||| |||||| |||||| ||||||| |
|
|
| T |
37092113 |
tagggatattgtatattatatgctggggccagggttcgaaccccg |
37092157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 39712335 - 39712271
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||| ||||||||| | | ||||||||||||||||| |
|
|
| T |
39712335 |
gatattgcatattatatgtaggggtcggaattcgaaccccggatatcccacttctccacatttaa |
39712271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 41454902 - 41454854
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
41454902 |
agggataatgcacaatatgtgcaggggccggggttcgaaccccggacac |
41454854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 41865126 - 41865062
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||| ||||||||||||||||| | |||||| |||||| |||||| || || ||||||||||| |
|
|
| T |
41865126 |
gatattacatattatatgcaggggtcagggttcgaaccccagacactccatttttccacatttaa |
41865062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 43847734 - 43847770
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
43847734 |
tattatatgcaggggccggggttcgaaccccgaacac |
43847770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 163
Target Start/End: Complemental strand, 44053456 - 44053396
Alignment:
| Q |
104 |
ggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||| | |||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
44053456 |
ggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactagg |
44053396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 116
Target Start/End: Complemental strand, 45190603 - 45190563
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccg |
116 |
Q |
| |
|
||||||||||||||||||||||||| | ||||| ||||||| |
|
|
| T |
45190603 |
gatattgcatattatatgcaggggctgaggttcgaaccccg |
45190563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 908 - 806
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||||||| |||| |||||||| | |||| |
|
|
| T |
908 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagctctagccactaggctacttg |
809 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
808 |
acc |
806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 167)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 3766833 - 3766935
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
3766833 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
3766932 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
3766933 |
acc |
3766935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 44616624 - 44616715
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
44616624 |
tagggatattgcatattatatgcaggagccggggttcaaaacccggacactccacttctccacaattaaattgtgtgagctctaaccactag |
44616715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 9877315 - 9877213
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
9877315 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagttctagccactaggctccttg |
9877216 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
9877215 |
acc |
9877213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 29617427 - 29617529
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
29617427 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
29617526 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
29617527 |
acc |
29617529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 21066908 - 21067008
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||| || |||||||| |||| |||||||| | |||| |
|
|
| T |
21066908 |
tagggatattgcatattatatgtaggggccggggttcgaaccccggacatctcacttctccacattt-aattgtgcgagctctagccactaggctacttg |
21067006 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
21067007 |
ac |
21067008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 164
Target Start/End: Complemental strand, 30388555 - 30388462
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| ||||||||| |
|
|
| T |
30388555 |
tagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactaggt |
30388462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 31026241 - 31026342
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
31026241 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
31026340 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
31026341 |
ac |
31026342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 1563787 - 1563695
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||| ||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
1563787 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctctacaattaaattgtgtgagctctaaccactagg |
1563695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 23102606 - 23102514
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
23102606 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagttctagccactagg |
23102514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 32047111 - 32047203
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
32047111 |
tagggatattgcatgttatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaattgtgtgagctctagccactagg |
32047203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 12640637 - 12640535
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
12640637 |
tagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
12640538 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
12640537 |
acc |
12640535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 19753016 - 19752914
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
19753016 |
tagggatattgcatattatatgcaggggccggggttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctacttg |
19752917 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
19752916 |
acc |
19752914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 24781052 - 24781154
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
24781052 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
24781151 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
24781152 |
acc |
24781154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 32676990 - 32676900
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
32676990 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccacta |
32676900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 35950150 - 35950252
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
35950150 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
35950249 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
35950250 |
acc |
35950252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 15238911 - 15239012
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
15238911 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccataatttaattgtgtgagctctagccactaggctacttg |
15239010 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
15239011 |
ac |
15239012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 32984265 - 32984173
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||| |||| | ||||||||||||||||||||||| ||||||||||| ||||| |||| ||| |||||||| |||| |
|
|
| T |
32984265 |
tagggatattgcatattatatacaggagtcggggttcaaaccccggacactctacttctccacaattaaattgtgtgagctctaaccattagg |
32984173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 36174412 - 36174503
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||| |||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
36174412 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttttccacaattaaattgtgtgagctctagccactag |
36174503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 10244937 - 10244835
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
10244937 |
tagggatattgcatattatatgtaggagccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
10244838 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
10244837 |
acc |
10244835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 15074950 - 15074860
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| || ||||||||| |||||||||||| ||||| | || ||| |||| ||||||| |
|
|
| T |
15074950 |
tagggatattgcatattatatgcagggaccggggttcgaatcccggacacccacttctccacaattaaattatgtgagctctagccactag |
15074860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 26801777 - 26801675
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| ||||||||||||| ||||||| |||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
26801777 |
taggaatattgcatattatatgcaggagccggggttcgaaccccggacactccacttcttcacaattaaattgtgtgagctctagccactaggctacttg |
26801678 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
26801677 |
acc |
26801675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 32619375 - 32619473
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
32619375 |
ggatattgcatattatatgtaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
32619473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 35645621 - 35645723
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
35645621 |
tagggatattgtatattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
35645720 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
35645721 |
acc |
35645723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 36391952 - 36391850
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||| || | |||| |
|
|
| T |
36391952 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactgggctacttg |
36391853 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
36391852 |
acc |
36391850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 42443711 - 42443813
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| || |||||||||| |||||||||||| |||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
42443711 |
tagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaagttgtgtgagctctagccactaggctacttg |
42443810 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
42443811 |
acc |
42443813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 48119492 - 48119594
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| ||||||||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
48119492 |
tagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
48119591 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
48119592 |
acc |
48119594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 4960806 - 4960907
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
4960806 |
tagggatattgcatattatatgcaggagtcggggttcgaacccctgacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
4960905 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
4960906 |
ac |
4960907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 8174138 - 8174239
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||||| || ||||||| |||||||||||||| ||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
8174138 |
tagggatattgcattttatatgcaggagctggggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctagccactaggcttcttg |
8174237 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
8174238 |
ac |
8174239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 76 - 172
Target Start/End: Complemental strand, 18503524 - 18503427
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||||||||| | ||||| |||||| ||||| | |||||||||||||||||||||| ||| | ||||||||||| | |||||| |
|
|
| T |
18503524 |
gatattgcatattatatgcaggggctgaggttcgaaccccagacaccccacttctccacatttaaaatgtgtgagctttaaccactaggctacttgac |
18503427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 73 - 173
Target Start/End: Original strand, 27424862 - 27424962
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||| ||| ||||||||||||||| || |||| ||| |||| |||||||| | ||||| |
|
|
| T |
27424862 |
agggatattgcatattatatgcaggggccggggttcgaacctcggatactccacttctccacattt-aattgtgtgagctctagccactaggctacttga |
27424960 |
T |
 |
| Q |
172 |
cc |
173 |
Q |
| |
|
|| |
|
|
| T |
27424961 |
cc |
27424962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 43633138 - 43633037
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||| || |||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |||||| |
|
|
| T |
43633138 |
tagggatattatatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggctgcttg |
43633039 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
43633038 |
ac |
43633037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 74 - 173
Target Start/End: Original strand, 13720794 - 13720894
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||| | || || |||| ||| |||| |||||||| | |||||| |
|
|
| T |
13720794 |
gggatattgcatattatatgcaggggccggggttcgaaccccgaacactccacttctccaaaatttaattgtgtgagctctagccactaggctacttgac |
13720893 |
T |
 |
| Q |
173 |
c |
173 |
Q |
| |
|
| |
|
|
| T |
13720894 |
c |
13720894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 13702056 - 13702139
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| | |||| |||||||||||||||||| ||| || | |||||||| |
|
|
| T |
13702056 |
tgcattttatatgcaggggccggggttcaaaccccggacaccccactcctccacatttaaaatgtgtgagctccagccactagg |
13702139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 24061377 - 24061286
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
24061377 |
taggaatattgcatattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccactag |
24061286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 7525469 - 7525567
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||||||||| || ||||| || |||||||||| ||||||||||| ||||| |||| ||| |||| |||||||||| |||||| |
|
|
| T |
7525469 |
ggatattgcatattatatgcaggggtcgaggttcgaattccggacactctacttctccacaattaaattgtgtgagctctagccactaggttacttgac |
7525567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 9712246 - 9712172
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||| | |||||||||||| ||||| |||| |
|
|
| T |
9712246 |
tagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtg |
9712172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 12772137 - 12772239
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||| ||| |||||||||| | ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
12772137 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggatactccacttctccataattaaattgtgtgagctctagccactaggctacttg |
12772236 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
12772237 |
acc |
12772239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 24880500 - 24880398
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
24880500 |
tagggatattgaatattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccaataggctacttg |
24880401 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
24880400 |
acc |
24880398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 27510305 - 27510203
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| | ||||| ||||| || ||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
27510305 |
tagggatattgcatattatatgcaggagccggggttcgatccccgtacactccatttctccacaattaaattgtgtgagctctagccactaggctacttg |
27510206 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
27510205 |
acc |
27510203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 31769560 - 31769458
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |||||| ||||||| ||||||||||| ||||| |||| ||| | || |||||||| | |||| |
|
|
| T |
31769560 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccagacactctacttctccacaattaaattgtgtgagctttagccactaggctacttg |
31769461 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
31769460 |
acc |
31769458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 74 - 138
Target Start/End: Complemental strand, 1398949 - 1398884
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacattta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||| | |||||||||||||||| |
|
|
| T |
1398949 |
gggatattgcatattatatgcaggggccggggttcgaatcccggacaccccacttctccacattta |
1398884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 34267599 - 34267498
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||| || ||||||| |||||||||||| ||||||||||||| ||||| |||| ||| |||| ||||||| | |||| |
|
|
| T |
34267599 |
taggaatattgcatattatatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagtcactaggctacttg |
34267500 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
34267499 |
ac |
34267498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 48719821 - 48719922
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
48719821 |
taggaatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
48719920 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
48719921 |
ac |
48719922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 76 - 163
Target Start/End: Original strand, 11745213 - 11745301
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| || |||||||||||||| ||||||||||| ||||| | || ||| ||||||||||||| |
|
|
| T |
11745213 |
gatattgcattttatatgcaggggtcgggggtcgaaccccggacactctacttctccacaattaaattatgtgagctctaaccactagg |
11745301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 12264076 - 12264168
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||| ||||| | ||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
12264076 |
tagggatattgcattttatatgcaggggccggagttcgaaccctgaacactccacttctccacaattaaattgtgtgagctctatccactagg |
12264168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 24508848 - 24508940
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
24508848 |
tagggatattgcatattatatgatggagccggggttcgaaccccggacattccacttctccacaattaaattgtgtgagctctagccactagg |
24508940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 159
Target Start/End: Original strand, 30806137 - 30806225
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||| |
|
|
| T |
30806137 |
tagggatattgcatattatatgcaggggtcggagttcgaaccccggacatcccacttctccacaattaaattgtgtgagttctagccac |
30806225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 2228997 - 2229080
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| || | |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
2228997 |
tagggatattgcatattatatgcaggggccggggtttaaaccccgagcaccccacttctccacaattaaattgtgtgagctcta |
2229080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 21388545 - 21388596
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
21388545 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactc |
21388596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 28805322 - 28805413
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| ||||||||||| | |||||||||||| ||||| || | ||| |||||||||||| |
|
|
| T |
28805322 |
tagggatattgcatatcatatgcaggggtcggggttagaaccccggacaccccacttctccacaattaaattgagtgagctctaaccactag |
28805413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 2681118 - 2681192
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| | |||||||||| ||||| |||| |
|
|
| T |
2681118 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccccttctccacaattaaattgtg |
2681192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 15106739 - 15106665
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |||||| |||||| |||||||||||| ||||| |||| |
|
|
| T |
15106739 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttctccacaattaaattgtg |
15106665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 74 - 163
Target Start/End: Complemental strand, 21875674 - 21875584
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||| ||||||||||||| ||||| |||| | ||||| |||| ||| |||||||| |||| |
|
|
| T |
21875674 |
gggatattgcatattatatgcaggggtcggagttcgaaccccggacactccacttttccataattaaattgtgtgagctctaaccattagg |
21875584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 32074443 - 32074341
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| ||| |||||||||||||| ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| | |||||| | |||| |
|
|
| T |
32074443 |
tagggatatcacattttatatgcaggggctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagctactaggctacttg |
32074344 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
32074343 |
acc |
32074341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 33996929 - 33996839
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||| ||||||| |||||||||| | ||||| |||| ||| |||| |||||| |
|
|
| T |
33996929 |
tagggatattgcatattatatgcaggagtcggggttcgaaccctggacactccacttctccataattaaattgtgtgagctctagccacta |
33996839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 38889541 - 38889439
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| ||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
38889541 |
tagggatattgcatattatatgcaggggctgaggttcgtaccccagacactccacttctccacaatttaattgtgtgagctctatccactaggctacttg |
38889442 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
38889441 |
acc |
38889439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 9497988 - 9498057
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||||||||||| | |||||||||||| ||||| |
|
|
| T |
9497988 |
tagggatattgcatattatatgtaggggtcggggttcgaaccccggacaccccacttctccacaattaaa |
9498057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 160
Target Start/End: Original strand, 14204294 - 14204383
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |||| |||||||| |||||||||||| || || |||| | | |||||||||| |
|
|
| T |
14204294 |
tagggatattgcatattatatgtaggggctggggttcgaacctcggacactccacttctccacaatttaattgtgtgggctctaaccact |
14204383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 25833577 - 25833678
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| || ||| |||||||||||| || || |||| || |||| |||||||| | |||| |
|
|
| T |
25833577 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtaagctctagccactaggctacttg |
25833676 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
25833677 |
ac |
25833678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 81 - 145
Target Start/End: Original strand, 46645740 - 46645805
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
46645740 |
tgcattttatatgcaggggccggggttcgaaccccggacaccccactcctccacatttaaaatgtg |
46645805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 79 - 139
Target Start/End: Original strand, 47437963 - 47438024
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | ||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47437963 |
attgcataatttatgcaggggcaggggttcaaaccccggacactccacttctccacatttaa |
47438024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 13730141 - 13730077
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| || ||||||| |||||| |
|
|
| T |
13730141 |
gatattgcatattatatgcaggggccggggtttgaaccccggacactccatttctccatatttaa |
13730077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 81 - 152
Target Start/End: Complemental strand, 20101691 - 20101619
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||| | ||||||||| ||||||||| || |||||| |
|
|
| T |
20101691 |
tgcatattatatgcaggggccggggttcgaactccggacaccctacttctccatatttaaaatatgtgagatc |
20101619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 20421807 - 20421715
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| ||||| |||| ||||||||||||||||||||||||| ||| || |||||||||| |
|
|
| T |
20421807 |
tagggatattgcatattatatgcgggggatatggttcgaaccctagacatctcacttctccacatttaaaatgtgtgagctcgaaccactagg |
20421715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 73 - 140
Target Start/End: Original strand, 22774063 - 22774131
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
||||| |||||||| | ||||||||||| ||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
22774063 |
agggacattgcataatttatgcaggggcaggggttcaaaccccggacaccccacttctccacatttaaa |
22774131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 73 - 140
Target Start/End: Original strand, 27788292 - 27788360
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| |||||| |||| | |||||||||||||||||| |
|
|
| T |
27788292 |
agggatattgcataatttatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaa |
27788360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 73 - 140
Target Start/End: Original strand, 27791448 - 27791516
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| |||||| |||| | |||||||||||||||||| |
|
|
| T |
27791448 |
agggatattgcataatttatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaa |
27791516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 159
Target Start/End: Original strand, 29238937 - 29239025
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
|||| ||||||||| |||| ||||||||| ||||||| |||||||||||| |||||||||||| ||||| |||| |||||||| |||| |
|
|
| T |
29238937 |
taggaatattgcattttatgtgcaggggcaggggttcgtaccccggacactccacttctccacaattaaattgtgtgagatctagccac |
29239025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 35683175 - 35683083
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||| ||| ||||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| |
|
|
| T |
35683175 |
tagggatatcgcattttatatgcaggggtcggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctatccattagg |
35683083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 41465856 - 41465924
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| ||| ||||||| | ||||||||||||||||| |
|
|
| T |
41465856 |
tagggatattgcatattatatgcaggggtcagggttcgaactccggacaccccacttctccacatttaa |
41465924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 75 - 154
Target Start/End: Complemental strand, 48674607 - 48674527
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||| | ||||| |||| ||| |||| |
|
|
| T |
48674607 |
ggatattgcattttatatgcaggggttggggttcaaaccccggacactccacttctccataattaaattgtgtgagctcta |
48674527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 3532600 - 3532691
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||| |||||| ||||| |||||||| ||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
3532600 |
tagggatattgcataatatatgcaggggccgaggttcgaaccccaaacactccacttctctacaattaaattgtgtgagctctagccactag |
3532691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 12007842 - 12007775
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||| ||| | ||||||||||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
12007842 |
tagggacattgtataatttatgcaggggctggggttcgaaccccggacactcacttctccacaattaa |
12007775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 12615773 - 12615864
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||| ||| ||||||| | | |||||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
12615773 |
tagggatattgcatattatatgcaggggttgggattcgaactccggacaccccgcttctccacaattaaattgtgtgagctctaaccactag |
12615864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 31077951 - 31077860
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| || ||||| |||||||||| ||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
31077951 |
tagggatattacactttatacgcaggggccgcggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
31077860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 75 - 161
Target Start/End: Complemental strand, 31191645 - 31191558
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| ||||||||||||| ||||||| |||| ||||| |||| ||| |||| |||||| |
|
|
| T |
31191645 |
ggatattgcatattatatgcagggatcggagttcgaaccccggacactccacttctgcacaattaaattgtgtgagctctagccacta |
31191558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 46534796 - 46534713
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
46534796 |
tagggatattgcatattatatgcaggagcctgagttcgaaccccgaacactccacttctccacaattaaattgtgtgagctcta |
46534713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 47641067 - 47641130
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |||||| |||||| |||||||||||| |
|
|
| T |
47641067 |
tagggatattgcatattatatgtaggggctggggttcgaaccccagacactccacttctccaca |
47641130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 154
Target Start/End: Original strand, 48447775 - 48447854
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
48447775 |
gatatcgcattttatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctcta |
48447854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 3062797 - 3062898
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| |||||| ||||||| || ||| |||||||||| |||||||||||||| ||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
3062797 |
taggaatattgtatattat-tgaaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
3062895 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
3062896 |
acc |
3062898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 24188492 - 24188566
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| |||||| |||| | |||||||||||| ||||| |||| |
|
|
| T |
24188492 |
tagggatactgcatattatatgcaggggtcggggttcgaaccccagacaccccacttctccacaattaaattgtg |
24188566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 36389714 - 36389652
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccaca |
134 |
Q |
| |
|
||||||||||| || ||||||||||||||||| |||| ||| |||||||| |||||||||||| |
|
|
| T |
36389714 |
tagggatattgtattttatatgcaggggccggagttcgaactccggacacccacttctccaca |
36389652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 36469753 - 36469651
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||||||||| ||||||||||||| |||||||||| | || || |||| ||| ||| |||||||| | |||| |
|
|
| T |
36469753 |
tagggatattacatattacatgcaggagccggggttcgaaccccggacactccacttctccataatttaattgtgtgagcgctagccactaggctacttg |
36469654 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
36469653 |
acc |
36469651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 83 - 121
Target Start/End: Original strand, 37665774 - 37665812
Alignment:
| Q |
83 |
catattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37665774 |
catattatatgcaggggccggggttcaaaccccggacac |
37665812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 42548076 - 42547974
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||| ||| ||||||| |||||| ||||||| |||| ||||||||| ||||||||||| ||||| |||| ||| |||||||| |||| | |||| |
|
|
| T |
42548076 |
taggaatattacattttatatgtaggggctggggttcgaacctcggacactctacttctccacaattaaattgtgtgagttctaaccattaggctacttg |
42547977 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
42547976 |
acc |
42547974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 42798364 - 42798291
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| ||| ||| |||| | |||||||||||||||||||||| |
|
|
| T |
42798364 |
tagggatattgcatattatatgc-ggggctggggttcgaactccgaacacccgacttctccacatttaaaatgtg |
42798291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 47999802 - 47999904
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||| || ||||||| || |||||||||| |||||||||| | ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
47999802 |
tagggatattgcatattatatgtaggagctggggttcgaatcccggacactccacttctccataattaaattgtgtgagctctagccattaggctacttg |
47999901 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
47999902 |
acc |
47999904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 29281391 - 29281299
Alignment:
| Q |
72 |
tagggatattgcatatt-atatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||| ||| |||||| ||| ||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
29281391 |
tagggatattgcatatttatatccaggggtcggggttcgaacaccggacgctccacttctccacaattaaattgtgtgagctctagccactag |
29281299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 35815860 - 35815952
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||| || ||| |||||| |||||||||||| ||||| |||| ||| |||| ||| |||| |
|
|
| T |
35815860 |
tagggatatcgcattttatatgcaggggtcggggttcgaatcccagacactccacttctccacaattaaattgtgtgagctctagccattagg |
35815952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 2291581 - 2291518
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| ||| | ||||||| |||||||||||| |
|
|
| T |
2291581 |
tagggatattacatattatatgcaggggtcggggttcgaacactggacactccacttctccaca |
2291518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 158
Target Start/End: Complemental strand, 26944210 - 26944123
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||| | |||| | | ||||||||||||||| |||| ||| |||||||| |
|
|
| T |
26944210 |
taggaatattgcatattatatgcaggggccggggtttgaaccatgcacactttagttctccacatttaaattgtgtgagctctaacca |
26944123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 28424379 - 28424288
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||| |||||||||||||||||| || || ||||| ||||||||| | | ||||||| |||| ||||| |||| ||| |||||||||||| |
|
|
| T |
28424379 |
tagggaaattgcatattatatgcagaggacgaggttcgaaccccggaaaccccacttcttcacaattaaattgtgtgagctctaaccactag |
28424288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 76 - 134
Target Start/End: Complemental strand, 28444126 - 28444067
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||| ||||||||||||| |||||||||||| |
|
|
| T |
28444126 |
gatatcgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccaca |
28444067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 32856965 - 32856902
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||| |||||| |||||| |||||||||||| |
|
|
| T |
32856965 |
tagggatattgcatattatatgcaggggctgaagttcgaaccccagacactccacttctccaca |
32856902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 158
Target Start/End: Complemental strand, 36114389 - 36114303
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
||||| ||||||||||||||||||| || |||||||| |||||| | | ||||||||||||||||| ||||||| ||| |||||||| |
|
|
| T |
36114389 |
taggggtattgcatattatatgcagcggtcggggttcgaaccccaaatatctcacttctccacattt-aaatgtgtgagctctaacca |
36114303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 87 - 145
Target Start/End: Original strand, 40200754 - 40200812
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
40200754 |
ttatatgcaggggccggggttcgaacccc-gacactccacttctccatatttaaaatgtg |
40200812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 115
Target Start/End: Original strand, 41084061 - 41084104
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaacccc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
41084061 |
tagggatattgcatattatatgcaggggtcggggttcgaacccc |
41084104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 42182246 - 42182195
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| ||| |||||||||| |
|
|
| T |
42182246 |
taggggtattgcatattatatgcaggggtcggggttcgaactccggacactc |
42182195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 90 - 144
Target Start/End: Complemental strand, 42435250 - 42435195
Alignment:
| Q |
90 |
tatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgt |
144 |
Q |
| |
|
||||||||||||||||||| |||||| || || ||||||||||||||||||||||| |
|
|
| T |
42435250 |
tatgcaggggccggggttcgaaccccagatacctcacttctccacatttaaaatgt |
42435195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 46758273 - 46758356
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||| ||||||| | |||| |||||||||||||||||| ||| || | |||||||| |
|
|
| T |
46758273 |
tgcattttatatgcaggggtcggggttcgaactccggacaccccactcctccacatttaaaatgtgtgagctccagccactagg |
46758356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 47287912 - 47287821
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| ||| ||||||| |||||| ||| ||| |||| ||||||||| ||||||||||| ||| | |||| |||||||| ||||||| |
|
|
| T |
47287912 |
tagggatattacattttatatgtaggggcagggattcgaacctcggacactccacttctccacaattacattgtgtgagatctagccactag |
47287821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 48288449 - 48288398
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| || ||||||||||| |
|
|
| T |
48288449 |
tagggatattgcatattatatgcaggagccgaggttcgaatcccggacactc |
48288398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 161
Target Start/End: Complemental strand, 6973539 - 6973453
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| | ||||| | |||||| ||| ||||| ||| ||| |||| |||||| |
|
|
| T |
6973539 |
ggatattgcatattatatgcaggggctggggttcgaacctcagacacccccttctcaacaattaaattgtatgagttctagccacta |
6973453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 10690869 - 10690943
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| |||||| ||| | |||||||||||| ||||| |||| |
|
|
| T |
10690869 |
tagggatattgcatattatatgcaggggtcggagttcgaaccccaaacaccccacttctccacaattaaattgtg |
10690943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 16200581 - 16200655
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| |||||| |||| | || ||||||||| ||||| |||| |
|
|
| T |
16200581 |
taggaatattgcatattatatgcaggggtcggggttcgaaccccagacaccccatttctccacaattaaattgtg |
16200655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 21762937 - 21762839
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| |||| | || | | |||||||||||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
21762937 |
ggatattgcatattatatgcaggggtcgggattcgaacctcagagaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
21762839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 76 - 122
Target Start/End: Complemental strand, 47255126 - 47255080
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact |
122 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
47255126 |
gatattgcatattatctgcaggagccggggttcgaaccccggacact |
47255080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 76 - 149
Target Start/End: Complemental strand, 48413970 - 48413896
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgag |
149 |
Q |
| |
|
|||||||||||||||||||||| || | | ||| ||| ||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
48413970 |
gatattgcatattatatgcaggagctgagattcgaactccggacactccacttctccacaattaaattgtgcgag |
48413896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 113
Target Start/End: Original strand, 27633953 - 27633994
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaacc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
27633953 |
tagggatattgcatattatatgcaggggtcggggttcgaacc |
27633994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 28914953 - 28914904
Alignment:
| Q |
73 |
agggatattgcatattatatgca-ggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
28914953 |
agggataatgcatattatatgcagggggccggggttcgaaccccggacac |
28914904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 81 - 141
Target Start/End: Original strand, 34891237 - 34891298
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaa |
141 |
Q |
| |
|
||||| |||||||||||||||||||||| ||| ||||||| | |||||||||| |||||||| |
|
|
| T |
34891237 |
tgcattttatatgcaggggccggggttcgaactccggacaccccacttctccatatttaaaa |
34891298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 35612615 - 35612546
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||| |||||||||||||||||| || |||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
35612615 |
tagggagattgcatattatatgcagaggttggggtttgaaccccggacactccacttctccacaattaaa |
35612546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 35835747 - 35835646
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| | || ||||||||| |||||||||||| |||| | |||||| |||||||||||| ||||| |||| ||| || | |||||||| | |||| |
|
|
| T |
35835747 |
tagggatatcgtattttatatgcaagggccggggttcgaacctcagacactccacttctccacaattaaattgtgtgagctccagccactaggctacttg |
35835648 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
35835647 |
ac |
35835646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 39098158 - 39098259
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| |||||| | |||| | ||||||||| ||||| ||| ||| |||| |||||||| | |||| |
|
|
| T |
39098158 |
tagggatattgcatattatatgcaagggccgggattcgaaccccaaatactctatttctccacaattaaattgtatgagctctagccactaggctacttg |
39098257 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
39098258 |
ac |
39098259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 7465498 - 7465534
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7465498 |
tattatatgcaggggccggggttcgaaccccggacac |
7465534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 15025176 - 15025224
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||||||||||||| |||| |
|
|
| T |
15025176 |
agggataatgcatattttatacaggggccggggttcaaaccccgaacac |
15025224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 25318584 - 25318516
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||||| ||||||| |||||| |||||||| ||||| |
|
|
| T |
25318584 |
tagggatattgcattttatatgtaggagccggggttcgaaccccgaacactccactctccacaattaaa |
25318516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 108
Target Start/End: Original strand, 36622196 - 36622232
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36622196 |
tagggatattgcatattatatgcatgggccggggttc |
36622232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 81 - 121
Target Start/End: Complemental strand, 37995613 - 37995573
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37995613 |
tgcatgttatatgcaggggccggggttcaaaccccagacac |
37995573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 44437888 - 44437852
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44437888 |
tattatatgcaggggccggggttcgaaccccggacac |
44437852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 77 - 172
Target Start/End: Original strand, 47463958 - 47464054
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||| |||||| | |||||||||||| ||||| |||| || |||| |||||||| | |||||| |
|
|
| T |
47463958 |
atattgcatgttatatgcaggggttggggttcgaacctcggacaccccacttctccacaattaaattgtgtgatctctatccactaggctacttgac |
47464054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 47543017 - 47542957
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | |||||||||||| |||||| || ||||||||| |||||||||| |||||| |
|
|
| T |
47543017 |
attgcataatttatgcaggggccagggttcgaatcccggacacccacttctccatatttaa |
47542957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 48433785 - 48433737
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
48433785 |
agggataatgcacaatatgtgcaggggccggggttcaaaccccggacac |
48433737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 158
Target Start/End: Complemental strand, 10671 - 10584
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||| | | ||| ||| ||| ||||| |||||||||||| || || |||| ||| |||||||| |
|
|
| T |
10671 |
tagggatattgcatattatatgcaggggatgtgattcgaactccgaacactccacttctccacaatttaattgtgtgagttctaacca |
10584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 5990193 - 5990131
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||||||| |||||||||||||| | |||| ||| ||||||||||||| |||||||||||| |
|
|
| T |
5990193 |
tagggatattgtatattatatgcaggcg-cgggattcgaaccccggacactccacttctccaca |
5990131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 7401435 - 7401344
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| |||| |||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
7401435 |
tagggatattgtatattatatgcaggaattggggtttgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactag |
7401344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 10226697 - 10226788
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||| ||||||||||||||||||||| || |||| | | |||||| | |||||||||||| ||||| |||| | | |||||||||||| |
|
|
| T |
10226697 |
tagggatgttgcatattatatgcaggggctggagttcgagcttcggacaccccacttctccacaattaaattgtgtgcgctctaaccactag |
10226788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 115
Target Start/End: Original strand, 23817210 - 23817253
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaacccc |
115 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
23817210 |
tagggatattgcatgttatatgtaggggtcggggttcaaacccc |
23817253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 28547814 - 28547727
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
||||||||||| | |||||||| ||||||| ||||| || ||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
28547814 |
ttatatgcaggaggcggggttcgaaccccgtacactccatttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
28547727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 134
Target Start/End: Original strand, 30940797 - 30940856
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||| |||| |||||||||||| |
|
|
| T |
30940797 |
gatattgcatattatatgcagaggccggggttcgaatcccgaacacaccacttctccaca |
30940856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 73 - 139
Target Start/End: Original strand, 36931996 - 36932063
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||| | ||||||||| ||||||||| ||||||||||| | |||||||| |||||||| |
|
|
| T |
36931996 |
agggacattgcataatttatgcagggtccggggttcgaaccccggacaccccacttctctacatttaa |
36932063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 38824673 - 38824622
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||| ||||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
38824673 |
tagggatattgcgtattatatgcaggggtcaaggttcgaaccccggacactc |
38824622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 73 - 139
Target Start/End: Original strand, 41854020 - 41854087
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||| | |||||||||| ||| |||||||||||||||| | | ||||||||||||||| |
|
|
| T |
41854020 |
agggacattgcataatttatgcaggggacggagttcaaaccccggacaccccgcttctccacatttaa |
41854087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 123
Target Start/End: Complemental strand, 41913808 - 41913761
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||| |||||||||||||| |
|
|
| T |
41913808 |
gatattgcattttatatgcaggggtcagggttcgaaccccggacactc |
41913761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 91 - 173
Target Start/End: Complemental strand, 43119461 - 43119378
Alignment:
| Q |
91 |
atgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
||||||||| |||||||| ||||| |||||| | ||||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
43119461 |
atgcaggggtcggggttcgaaccctggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
43119378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 45284867 - 45284777
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||| |||| ||| | |||||||||| |||||||| ||||||||||| | |||||||| |||||| || |||| ||| |||||||||||| |
|
|
| T |
45284867 |
tagggacattgaataatttatgcaggggtcggggttcgaaccccggacaccccacttctcaacattt-aattgtgtgagctctaaccactag |
45284777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 75 - 121
Target Start/End: Original strand, 3392492 - 3392538
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||| ||||| |
|
|
| T |
3392492 |
ggatattgcatattatatgtaggggtcggggttcgaaccccagacac |
3392538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 5804877 - 5804967
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||| ||||||||| |||||| ||||| ||||||| | | | |||||||||||| || || |||| ||| |||| |||||| |
|
|
| T |
5804877 |
tagggatattgcattttatatgcaagggccgaggttcgaaccccgtatattccacttctccacaatttaattgtgtgagctctagccacta |
5804967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 18223765 - 18223691
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||| | | |||| |||| ||||||||||| | |||||||||||| ||||| |||| |
|
|
| T |
18223765 |
tagggatattgcatattatatgtaagatccggagttcgaaccccggacaccccacttctccacaattaaattgtg |
18223691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 121
Target Start/End: Complemental strand, 21285414 - 21285380
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
21285414 |
ttatatgcaggggccggggttcgaaccccggacac |
21285380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 23755062 - 23754988
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||||||| ||||||||||| | | ||| |||| | |||| | |||||||||| |||||||||||| |
|
|
| T |
23755062 |
tagggatattgcatattttatgcaggggctgagattcgaacctcagacaccccacttctccatatttaaaatgtg |
23754988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 99 - 156
Target Start/End: Original strand, 26122079 - 26122137
Alignment:
| Q |
99 |
gccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaac |
156 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||||| |
|
|
| T |
26122079 |
gccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaac |
26122137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 121
Target Start/End: Complemental strand, 29658333 - 29658299
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
29658333 |
ttatatgcaggggccggggttcgaaccccggacac |
29658299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 77 - 134
Target Start/End: Complemental strand, 33636841 - 33636783
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccaca |
134 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
33636841 |
atattgcattatatatgcaggggctggggttcgaaccccggacatttcacttctccaca |
33636783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 45640140 - 45640038
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||||| ||| ||||||||| |||||||| | | ||||| |||| ||| |||| ||||||| | |||| |
|
|
| T |
45640140 |
tagggatattgtatattatatgcaggaactggggttcgaactccggacactccacttctctataattaaattgtgtgagctctagtcactaggctacttg |
45640041 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
45640040 |
acc |
45640038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 73 - 119
Target Start/End: Complemental strand, 46570046 - 46570000
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggac |
119 |
Q |
| |
|
||||||| |||||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
46570046 |
agggataatgcatagtttatgcaggggccggggttcgaaccccggac |
46570000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 81 - 162
Target Start/End: Complemental strand, 47440849 - 47440767
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||| |||||||||||| |||||||| ||||| ||||| | |||||||||||||| || ||||| ||| || | ||||||| |
|
|
| T |
47440849 |
tgcataatatatgcaggggtcggggttcgaaccctggacaccccacttctccacattaaatatgtgtgagctccagccactag |
47440767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 9233810 - 9233738
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||| || ||||||||| |||||||||| |||||| | |||||||| ||| ||||| ||||| |||| |
|
|
| T |
9233810 |
tagggatattgaattttatatgca-gggccggggtccaaacctcagacactcaattccccacaattaaattgtg |
9233738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 144
Target Start/End: Original strand, 12428217 - 12428286
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaac-cccggacactc-acttctccacatttaaaatgt |
144 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||| ||| |||| | ||||||||||||||||||||| |
|
|
| T |
12428217 |
atattgcatattatatgcaggggttggggttcgaactcccaaacacccaacttctccacatttaaaatgt |
12428286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 23274862 - 23274813
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| |||||||| | |||||||||||||| |||| |||||||||||| |
|
|
| T |
23274862 |
tagggacattgcataatttatgcaggggccggagttcgaaccccggacac |
23274813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 80 - 172
Target Start/End: Complemental strand, 45669813 - 45669720
Alignment:
| Q |
80 |
ttgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||||||||||| || ||||||||| ||||| |||| ||| |||| | |||||| | |||||| |
|
|
| T |
45669813 |
ttgcatattatatgcaacagccgaggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctatctactaggctacttgac |
45669720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 2261547 - 2261511
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| |
|
|
| T |
2261547 |
tattatatgcaggggccggggttcgaatcccggacac |
2261511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 7779044 - 7778976
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||| ||| | |||||| | ||||| |||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
7779044 |
tagggacattgtataatttatgcaagtgccggagttcgaaccccggacactccacttctccacatttaa |
7778976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 14102493 - 14102529
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14102493 |
tattatatgcaggggccggggtttgaaccccggacac |
14102529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 14412510 - 14412546
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14412510 |
tattatatgcaggggccggggtttgaaccccggacac |
14412546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 23685617 - 23685581
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
23685617 |
tattatatgcaggggccggggttcgaaccccagacac |
23685581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 139
Target Start/End: Original strand, 25155567 - 25155631
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaa |
139 |
Q |
| |
|
|||| |||||||| ||||||||| |||||||| ||||| |||||| | |||||||||||||||| |
|
|
| T |
25155567 |
gataatgcatattttatgcagggttcggggttcgaaccctggacaccccacttctccacatttaa |
25155631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 27047778 - 27047742
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
27047778 |
tattatatgcaggggccggggttcgaacctcggacac |
27047742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 27425110 - 27425178
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||||||||| | ||||| |||||||||||| | |||||| ||||||||| |
|
|
| T |
27425110 |
tagggacattgcataatttatgcaggggcagtggttcgaaccccggacacccgacttcttcacatttaa |
27425178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 87 - 127
Target Start/End: Original strand, 30741598 - 30741638
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacactcactt |
127 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
30741598 |
ttatatgcaggggccggtgttcgaaccccggacacccactt |
30741638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 35195875 - 35195911
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
35195875 |
tattatatgcaggggccggggttcgaaccccgaacac |
35195911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 36316037 - 36316001
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
36316037 |
tattatatgcaggggccggggttcgaacctcggacac |
36316001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 40273841 - 40273889
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
40273841 |
agggataatgcacaatatgtgcaggggccggggttcgaaccccggacac |
40273889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 44662538 - 44662490
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| ||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
44662538 |
agggataatgcattatgtatgcaggggccggggttcgaaccccggacac |
44662490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 47552245 - 47552281
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
47552245 |
tattatatgcaagggccggggttcgaaccccggacac |
47552281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 47880178 - 47880214
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| |
|
|
| T |
47880178 |
tattatatgcaggggccggggttcgaatcccggacac |
47880214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 81 - 121
Target Start/End: Original strand, 48525605 - 48525645
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
48525605 |
tgcatattatatgcaggggttggggttcgaaccccggacac |
48525645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 176)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 14641157 - 14641055
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||||||| |||| |||||||| | |||| |
|
|
| T |
14641157 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagctctagccactaggctacttg |
14641058 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
14641057 |
acc |
14641055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 8241072 - 8241164
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| ||||||||||| | ||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
8241072 |
tagggatattgcatattatatgcaagggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctctaaccactagg |
8241164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 8968771 - 8968873
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
8968771 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
8968870 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
8968871 |
acc |
8968873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 12463778 - 12463880
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
12463778 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
12463877 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
12463878 |
acc |
12463880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 25400415 - 25400313
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
25400415 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
25400316 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
25400315 |
acc |
25400313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 6518824 - 6518723
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||||| |||| |
|
|
| T |
6518824 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggttacttg |
6518725 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
6518724 |
ac |
6518723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 9835055 - 9835156
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
9835055 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
9835154 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
9835155 |
ac |
9835156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 35515534 - 35515635
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
35515534 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccactaggctacttg |
35515633 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
35515634 |
ac |
35515635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 42525422 - 42525513
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
42525422 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
42525513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 4417733 - 4417631
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||| ||| | |||| |
|
|
| T |
4417733 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccaccaggctacttg |
4417634 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
4417633 |
acc |
4417631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 4745924 - 4745822
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
4745924 |
tagggatattgcatattatatgaaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
4745825 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
4745824 |
acc |
4745822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 11774507 - 11774405
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| || ||||| | |||| |
|
|
| T |
11774507 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccgctaggctacttg |
11774408 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
11774407 |
acc |
11774405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 41179851 - 41179761
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| || |||||||||| |||||||||||||||||| |||| ||| |||| |||||| |
|
|
| T |
41179851 |
tagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacatttaaattgtgtgagctctagccacta |
41179761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 17545220 - 17545119
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
17545220 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccataatttaattgtgtgagctctagccactaggctacttg |
17545121 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
17545120 |
ac |
17545119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 11897270 - 11897361
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
11897270 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
11897361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 17175099 - 17175008
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||| |||||||| |||||||||||| ||| | |||| |||||||||| ||||| |
|
|
| T |
17175099 |
tagggatattgcatgttatatgcaggggccggggttcgaacctcggacactccacttctccacaattatattgtgtgagatctaacaactag |
17175008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 18638620 - 18638711
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
18638620 |
tagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
18638711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 32505710 - 32505793
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
32505710 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
32505793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 43580900 - 43580991
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| || |||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
43580900 |
tagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactag |
43580991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 5966851 - 5966925
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
5966851 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
5966925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 11188730 - 11188628
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
11188730 |
taggaatattgcatattatatgcaggggctggggttcaaaccccagacactcaacttctccacaatttaattgtgtgagctctagccactaggctacttg |
11188631 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
11188630 |
acc |
11188628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 24033099 - 24033201
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
24033099 |
tagggatattgcattttatatgcaggggccggggttcgaaccccggacacgccacttctccacaattaaattgtgtgagctctagccattaggctacttg |
24033198 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
24033199 |
acc |
24033201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 27765279 - 27765381
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
27765279 |
tagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
27765378 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
27765379 |
acc |
27765381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 36888443 - 36888353
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
36888443 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccacta |
36888353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 42320339 - 42320440
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| |||||||||| |||| |
|
|
| T |
42320339 |
tagggatattgcatattatatgcaggagtcggagttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccactaggttacttg |
42320438 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
42320439 |
ac |
42320440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 27798643 - 27798735
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| | ||| |||||| |||||||||||||| ||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
27798643 |
tagggatattgcatattatatgcaagagccagggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctagccactagg |
27798735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 138
Target Start/End: Original strand, 12891579 - 12891646
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacattta |
138 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
12891579 |
tagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccacttctccacattta |
12891646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 13621994 - 13621891
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcga-gatctaaccactaggttgctt |
169 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| || | |||| |||||||| | ||| |
|
|
| T |
13621994 |
tagggatatcgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgaggctctagccactaggctactt |
13621895 |
T |
 |
| Q |
170 |
gacc |
173 |
Q |
| |
|
|||| |
|
|
| T |
13621894 |
gacc |
13621891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 16386789 - 16386698
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
16386789 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactag |
16386698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 32423587 - 32423678
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||| |||||| |||||||||||| || || |||| ||| |||| ||||||| |
|
|
| T |
32423587 |
tagggatattgtatattatatgcaggggctggggttcaaaccccagacactccacttctccacaatttaattgtgtgagttctagccactag |
32423678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 36124421 - 36124512
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| || |||||||||| |||||||||||| || || |||| ||| |||||||||||| |
|
|
| T |
36124421 |
taggaatattgcatattatatgcaggggtcggggttcgaatcccggacactccacttctccacaatttaactgtgtgagctctaaccactag |
36124512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 138
Target Start/End: Complemental strand, 36716906 - 36716839
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacattta |
138 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
36716906 |
tagggatattgcatattatatgcagggaccggggtttgaaccccggacactcaacttctccacattta |
36716839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 39886260 - 39886169
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||| ||| || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
39886260 |
tagggatattgcatattatatgtaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
39886169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 41319499 - 41319408
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| |||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
41319499 |
tagggatattgcattttatatgcaggggtcggagttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
41319408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 2328614 - 2328688
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||| |||||| |||||||||||| ||||| |||| |
|
|
| T |
2328614 |
tagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtg |
2328688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 6558823 - 6558925
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||| |||||||| | ||||||||||| ||||| |||| ||| |||| ||||||| | |||| |
|
|
| T |
6558823 |
tagggatattgcatattatatgcaggggtcggggttcgaactccggacaccctacttctccacaattaaattgtgtgagctctagtcactaggctacttg |
6558922 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
6558923 |
acc |
6558925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 21918074 - 21918176
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| ||||||| | |||| |
|
|
| T |
21918074 |
tagggatattgcatattatatgcaggagctggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagtcactaggctacttg |
21918173 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
21918174 |
acc |
21918176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 41156350 - 41156452
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||| ||||||||| |||||||||||| ||||| ||| ||| |||| ||||||| | |||| |
|
|
| T |
41156350 |
tagggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaatcgtgtgagctctagtcactaggctacttg |
41156449 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
41156450 |
acc |
41156452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 81 - 165
Target Start/End: Complemental strand, 4418381 - 4418296
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggtt |
165 |
Q |
| |
|
||||| |||||||||||||| ||||||| |||| ||||||| ||| |||||||||||||||||||| ||| || |||||||||||| |
|
|
| T |
4418381 |
tgcattttatatgcaggggctggggttcgaacctcggacacctcatttctccacatttaaaatgtgtgagctccaaccactaggtt |
4418296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 76 - 172
Target Start/End: Original strand, 9125689 - 9125784
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||| | ||||| ||| |||| |||||||| | |||||| |
|
|
| T |
9125689 |
gatattgcatattatatgca-gggccggggttcgaaccccggacacctcacttctccacattt-atatgtgtgagctctagccactaggctacttgac |
9125784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 10404149 - 10404250
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||| | |||||||| ||||||||||||| || ||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
10404149 |
taggaatattgcatattatatgcaggagtcggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctacttg |
10404248 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
10404249 |
ac |
10404250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 546824 - 546916
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| || ||| | ||||||| |||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
546824 |
tagggatattgcatattatatgcaggggtcggggttcgaacctcgaacatcccacttcttcacaattaaattgtgtgagctctaaccactagg |
546916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 5900314 - 5900405
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||| | |||||||||||| || || |||| ||| |||||| |||||| |
|
|
| T |
5900314 |
tagggatattgcatattatatgcaggggcc-gggttcgaaccccggacattccacttctccacaatttaattgtgtgagctctaactactagg |
5900405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 75 - 139
Target Start/End: Complemental strand, 4238353 - 4238287
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccgga--cactcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| | | ||||||||||||||||| |
|
|
| T |
4238353 |
ggatattgcatattatatgcaggggccggggttcgaaccccggacgcccccacttctccacatttaa |
4238287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 76 - 162
Target Start/End: Original strand, 13958408 - 13958495
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||| | || || |||| ||| |||| ||||||| |
|
|
| T |
13958408 |
gatattgcatattatatgcaggggacggggttcgaaccccggacactccacttctccataatttaattgtgtgagctctagccactag |
13958495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 15241418 - 15241509
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| |||| |||||| | |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
15241418 |
taggaatattgcatattatatgcaggggtcggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactag |
15241509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 73 - 155
Target Start/End: Complemental strand, 16720653 - 16720570
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaa |
155 |
Q |
| |
|
|||||| || ||||||||||||||||| |||||||||||| ||||||| | ||||||| |||||||||||| |||||| ||||| |
|
|
| T |
16720653 |
agggatgttacatattatatgcaggggtcggggttcaaacaccggacaccccacttcttcacatttaaaatatgcgagctctaa |
16720570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 73 - 163
Target Start/End: Complemental strand, 21962152 - 21962061
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||| ||||||||| || |||||||||| ||||||||||||| ||||| |||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
21962152 |
agggatattgcaaattatatgcgggagccggggttcgaaccccggacactccacttttccacaattaaattgtgtgagctctagccactagg |
21962061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 28871363 - 28871280
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| ||||||||||||| |||||||| || |||||||||| ||||||||| ||||||||||||| ||| || |||||||||| |
|
|
| T |
28871363 |
tgcattttatatgcaggggtcggggttcgaatcccggacactccacttctccgcatttaaaatgtgtgagttccaaccactagg |
28871280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 39919141 - 39919090
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
39919141 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactc |
39919090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 172
Target Start/End: Complemental strand, 7545439 - 7545345
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||||| | || ||| || ||||||||| | |||||||||||||||||||||| ||| |||||||||| ||| |||||| |
|
|
| T |
7545439 |
attgcatattatatgcaggggtcaggattcgaatcccggacaccccacttctccacatttaaaatgtgtgagcgctaaccactatgttacttgac |
7545345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 77 - 162
Target Start/End: Complemental strand, 9688715 - 9688629
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||| ||||| ||||||| |||| ||||| |||| ||| |||||||||||| |
|
|
| T |
9688715 |
atattgcatattatatgcagaggtcggggttcgaaccccgaacactacacttcttcacaattaaattgtgtgagctctaaccactag |
9688629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 10905181 - 10905083
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||| || ||||||||||||| |||||||| ||||| |||||| ||||||||||||| || || |||||||| |||| |||||||| | |||||| |
|
|
| T |
10905181 |
ggatattgtattttatatgcaggggtcggggttcgaaccctggacacttcacttctccacaatttaattgtgcgagctctagccactaggctacttgac |
10905083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 13876365 - 13876279
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| ||||||||||||| || ||||||||| || || |||| ||| ||||||||||| |
|
|
| T |
13876365 |
gatattgtatattatatgcagcggccggggttcgaaccccggacactccatttctccacaatttaactgtgtgagctctaaccacta |
13876279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 17064906 - 17064805
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||| | ||||||||||||||| || |||| ||| |||| |||||||| | |||| |
|
|
| T |
17064906 |
tagggatattgcatattatatgcaggggccgacgtttgaaccccggacaccccacttctccacattt-aattgtgtgagttctagccactaggctacttg |
17064808 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
17064807 |
acc |
17064805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 25648133 - 25648031
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc-aaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgctt |
169 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| || |||| |||||| |||||||||||| ||||| |||| ||| |||| |||||||| | ||| |
|
|
| T |
25648133 |
tagggatattgcatattacatgcaggagccggggttcgaacccccagacactccacttctccacaattaaattgtgtgagctctagccactaggctactt |
25648034 |
T |
 |
| Q |
170 |
gac |
172 |
Q |
| |
|
||| |
|
|
| T |
25648033 |
gac |
25648031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 42916411 - 42916485
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| |
|
|
| T |
42916411 |
tagggatattgtatgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtg |
42916485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 87 - 163
Target Start/End: Original strand, 3740991 - 3741068
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| | ||||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
3740991 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactagg |
3741068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 156
Target Start/End: Complemental strand, 6735837 - 6735752
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaac |
156 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||||| |
|
|
| T |
6735837 |
tagggatatttcattttatatgcaggggtcggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctaac |
6735752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 132
Target Start/End: Original strand, 10241747 - 10241808
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctcca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
10241747 |
tagggatattgcatattatatgcaggggttggggttcaaaccccagacactccacttctcca |
10241808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 23937972 - 23937907
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
23937972 |
tgcattttatatgcaggggccggggttcgaaccccggacaccccactcctccacatttaaaatgtg |
23937907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 160
Target Start/End: Complemental strand, 25729488 - 25729399
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| ||||| |
|
|
| T |
25729488 |
tagggatatcgcattttatatgcaggggtcggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccact |
25729399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 35113010 - 35112941
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| |||||||||| ||||||||||| ||||| |
|
|
| T |
35113010 |
tagggatattgcatattatatgcaggggttggggttcgaactccggacactctacttctccacaattaaa |
35112941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 171
Target Start/End: Original strand, 988737 - 988836
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |||||| ||||| |||||||||||| ||||| |||| ||| ||| |||||||||| |||| |
|
|
| T |
988737 |
tagggatattgcatattatatgcaggagctggggttcgaacccc-aacactccacttctccacaattaaattgtgtgagctctggccactaggttacttg |
988835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 86 - 173
Target Start/End: Complemental strand, 2301605 - 2301517
Alignment:
| Q |
86 |
attatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||| || ||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
2301605 |
attatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
2301517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 76 - 163
Target Start/End: Original strand, 16280272 - 16280360
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||| ||||||||||||| |||| ||||||||||||| |||| ||| |||| |||||||| |
|
|
| T |
16280272 |
gatattgcattttatatgtaggggttggggttcgaaccccggacactccactcctccacatttaaattgtgtgagctctagccactagg |
16280360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 76 - 171
Target Start/End: Original strand, 18050205 - 18050301
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||||||||||||| |||||||||||| || || |||| ||| |||| | ||||| || ||||| |
|
|
| T |
18050205 |
gatattgcatattaaatgcaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagcaactagattacttga |
18050301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 27241663 - 27241754
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||||| |||| ||||| | | |||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
27241663 |
taggaatattacatattatatgcaggggtcggggtttaaactccggataccccacttctccaca-ttaaaatgtgcgagctctagccactagg |
27241754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 1743149 - 1743231
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| ||||||||||||| |||||||| ||| ||||| |||| ||| |||| |
|
|
| T |
1743149 |
tagggatattgcatattatatgcaggagcc-gggttcgaaccccggacactccacttctctacaattaaattgtgtgagctcta |
1743231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 3821460 - 3821377
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||||||||||| || |||||| | | ||||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
3821460 |
tgcattttatatgcaggggccggggttcgaatcccggaaaccccacttctccacatttaaaatgtgtgagctccagccactagg |
3821377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 162
Target Start/End: Original strand, 6526076 - 6526163
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||| ||||||||||||||||| || |||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
6526076 |
gatattggatattatatgcaggggctggagttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactag |
6526163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 11786108 - 11786017
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||| |||||| ||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
11786108 |
tagggatattgcattttatatgcaggggctgaggttcgaaccccacacactccacttctccacaattaaattgtgtgagctctagccactag |
11786017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 20707835 - 20707752
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| |||||| ||||| ||||||||||||| ||||| |||| ||| |||| |
|
|
| T |
20707835 |
tagggatattgcatactatatgcaggggttggggttcgaaccccagacacttcacttctccacaattaaattgtgtgagctcta |
20707752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 32706344 - 32706427
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||| ||||||||||| ||| |||||| ||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
32706344 |
tagggatattacatattatatggaggagccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
32706427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 41930127 - 41930218
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |||||| |||| | |||||||| ||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
41930127 |
tagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctctacaattaaattgtgtgagctctagccactag |
41930218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 154
Target Start/End: Original strand, 2148583 - 2148661
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| ||| | |||||| | |||| ||||||||||||||||||| |||| |
|
|
| T |
2148583 |
gatattgcatattatatgcaggggtcgaggttcgaactcaagacacttatttcttcacatttaaaatgtgcgagctcta |
2148661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 2848235 - 2848337
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||| | | |||||||| ||||||| |||| ||| ||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
2848235 |
tagggatattgtatattatatgcatgaggcggggttcgaaccccgcacacttcatttctccacaattaaattgtgtgagctctagccactaggctacttg |
2848334 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
2848335 |
acc |
2848337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 16603420 - 16603494
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||| |||||| ||||||| ||||||||||| ||||| |||| |
|
|
| T |
16603420 |
tagggatattgcatattatatgcagaagccgggattcgaaccccagacactctacttctccacaattaaattgtg |
16603494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 17891898 - 17891832
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccaca-tttaaaatgtg |
145 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
17891898 |
tgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacattttaaaatgtg |
17891832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 29154865 - 29154954
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||| |||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
29154865 |
tagggatagtgcatattatatgtaggagcc-gggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctagccacta |
29154954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 38097297 - 38097386
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc--acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| ||| | ||||| | |||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
38097297 |
ggatattgcatattatatgcaggggctgaggttcgaacatcagacacccccacttctccacatttaaaatgtgtgagctctagccactag |
38097386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 40091499 - 40091573
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||| | |||| ||||| ||| ||||||||| |||||||||||| ||||| |||| |
|
|
| T |
40091499 |
tagggatattgcatattatatgcaagagccgaggttcgaactccggacactccacttctccacaattaaattgtg |
40091573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 75 - 163
Target Start/End: Complemental strand, 11146574 - 11146485
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||| ||||||| ||||| || |||| ||||||||||||| |||||||||||| || || |||| ||| ||||||||||||| |
|
|
| T |
11146574 |
ggatattgcatgttatatgtaggggttggagttcgaaccccggacactccacttctccacagttcaattgtgtgagctctaaccactagg |
11146485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 21749425 - 21749325
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||| ||||||||||||||||| | ||| |||| || |||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
21749425 |
tagggatactgcatattatatgcaggagtcggtgttcgaa-cccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
21749327 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
21749326 |
ac |
21749325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 136
Target Start/End: Original strand, 26912855 - 26912920
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatt |
136 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||| |||| | ||||||||||||| |
|
|
| T |
26912855 |
tagggatattgcatattatatgtaggggccggggttcgaaccccaaacaccctacttctccacatt |
26912920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 29691379 - 29691480
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||| ||||| ||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
29691379 |
tagggatattgcatattatatttagaggccggagttcgaaccctggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
29691478 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
29691479 |
ac |
29691480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 77 - 149
Target Start/End: Complemental strand, 32226288 - 32226215
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgag |
149 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||| |||||| | |||||||||||| ||||| | |||||| |
|
|
| T |
32226288 |
atattgcatattatatgcaggggtcggggttcgaacctcggacaccccacttctccacaattaaattatgcgag |
32226215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 8750949 - 8750858
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| || |||||||| ||||||||||||| || || | || ||| ||||||||||||| |
|
|
| T |
8750949 |
tagggatattgcatattatatgca-gggctggggttcgaattccggacacttcacttctccacaatttaattatgagagctctaaccactagg |
8750858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 20145612 - 20145544
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||| | |||||| |||||||||||| |||| |||||| | ||||||||||||||||| |
|
|
| T |
20145612 |
tagggatattgcataatttatgcaagggccggggttcgaacctcggacaccccacttctccacatttaa |
20145544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 8478941 - 8478850
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| |||||| ||||| ||||||| |||| || || |||| ||| |||| ||||||| |
|
|
| T |
8478941 |
tagggatattgcatattatatgcaggggctgtggttcgaaccccatacactccacttcttcacaatttaattgtgtgagctctagccactag |
8478850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 10758848 - 10758761
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctc-cacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| ||||||| |||||| |||||||| |||| ||||| |||| ||| |||| |||||| |
|
|
| T |
10758848 |
gatattgcatattatatgtaggggctggggtttaaaccccagacactccacttctctcacaattaaattgtgtgagctctagccacta |
10758761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 119
Target Start/End: Original strand, 12767986 - 12768033
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggac |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
12767986 |
tagggatattgcatattatatgcaggagccggcgttcgaaccccggac |
12768033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 18928742 - 18928825
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||||| | |||||||||| ||| |||| |||| |||||| ||||||| |||||||||||| |||| ||| |||| |
|
|
| T |
18928742 |
tagggatattgcataatttatgcaggggtcggtgttcgaaccacggacacctcacttttccacatttaaattgtgtgagctcta |
18928825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 19985522 - 19985613
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||| ||||||||||| ||| |||| ||| |||||||||| ||||||||||| ||||| |||| ||| | || ||||||| |
|
|
| T |
19985522 |
tagggatattgcataatatatgcagggatcggagttcgaactccggacactcaacttctccacaattaaattgtgtgagctatatccactag |
19985613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 33736062 - 33735996
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || ||| ||||| || ||||||||| |||| |
|
|
| T |
33736062 |
tagggatattgcatattatatgcaggggtcggggttcgaa-ccctgacacccagttctccacaattaa |
33735996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 76 - 162
Target Start/End: Complemental strand, 34389656 - 34389570
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||| ||||||||| |||| ||||||||||| ||||| |||| ||| || | ||||||| |
|
|
| T |
34389656 |
gatattgcattttatatgcaggggcc-gggttcgaaccccggatactcaacttctccacaattaaattgtgtgagctcaagccactag |
34389570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 39165039 - 39165090
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |||||| ||||||| |
|
|
| T |
39165039 |
tagggatattgcatattatatgcaggagctggggttcgaaccccagacactc |
39165090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 9958599 - 9958673
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||| |||||||||| || ||||| ||||||||||| ||||||||||| || ||||| |||| |
|
|
| T |
9958599 |
tagggatattgcatatcatatgcagggatcgaggttcgaaccccggacacctcacttctccccaattaaattgtg |
9958673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 14624298 - 14624372
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| |||| ||||||| || |||||||||| ||||| |||| |
|
|
| T |
14624298 |
tagggatatcacattttatatgcaggggccggggttctaacctcggacacttcccttctccacaattaaattgtg |
14624372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 83 - 161
Target Start/End: Complemental strand, 15241187 - 15241110
Alignment:
| Q |
83 |
catattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||| |||| || |||| |||||| | ||||||||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
15241187 |
catattatatgcatgggctggagttcgaaccccaaaaactcacttctccaca-ttaaaatgtgtgagctctaaccacta |
15241110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 17666028 - 17666102
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||| ||||||||||||||||||||||| | |||||| ||||||||| ||| ||| |||||||| ||||| |||| |
|
|
| T |
17666028 |
taggaatattgcatattatatgcaggggtcagggttcgaaccccggatactccacctctccacaattaaattgtg |
17666102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 28308256 - 28308358
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| | |||| ||||| ||||||| ||||| ||||||| || | || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
28308256 |
tagggatattgcatattatatgcaagagccgaggttctaaccccgaacactccacttctgcataatttaattgtgtgagctctagccactaggctacttg |
28308355 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
28308356 |
acc |
28308358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 35512004 - 35511914
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||| ||| |||||||| ||||||||||||| ||||||||| ||| |||||||| ||| ||||| |||| ||| |||| |||||| |
|
|
| T |
35512004 |
tagggatatcacattttatatgctggggccggggttcgaaccccggaaactccacttctcgacaattaaattgtgtgagctctagccacta |
35511914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 109
Target Start/End: Complemental strand, 19273250 - 19273213
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttca |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19273250 |
tagggatattgcatgttatatgcaggggccggggttca |
19273213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 75 - 159
Target Start/End: Complemental strand, 19891471 - 19891386
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| || |||||| ||| |||||||||||| ||||| |||| ||| |||| |||| |
|
|
| T |
19891471 |
ggatattgcattttatatgcaggggttggggttcgaatcccggatactccacttctccacaattaaattgtgtgagctctatccac |
19891386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 79 - 140
Target Start/End: Original strand, 24456218 - 24456279
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||| | |||||||||| ||| |||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
24456218 |
attgcataatttatgcaggggtcggagttcgaaccccggacacccacttctccacagttaaa |
24456279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 28758466 - 28758397
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaacc-ccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | |||||||| | ||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
28758466 |
tagggacattgcataatttatgcaggagtcggggttcaaacctccggacacctcacttctccacatttaa |
28758397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 30571176 - 30571277
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| || |||| | ||||| |||||||||||| ||||| |||| || |||| || ||||||| |||| |
|
|
| T |
30571176 |
tagggatattgcatattatatgcaggggtcgggatttcaacctcagacacttcacttctccacgattaaattgtgtaagctctagccgctaggttacttg |
30571275 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
30571276 |
ac |
30571277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 30783758 - 30783701
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctcca |
132 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||| |||||||| ||||||||||| |
|
|
| T |
30783758 |
gatattgcatattatatgcagaggtcggggttcgaactccggacacttcacttctcca |
30783701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 1463903 - 1463939
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1463903 |
tattatatgcaggggccggggttcgaaccccggacac |
1463939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 2362991 - 2363083
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc-aaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||| |||||| ||||||| |||| || || |||| ||| |||| ||||||| |
|
|
| T |
2362991 |
tagggatattgcatattatatgcaggggttggggttcgaacccccagacactccacttcttcacaatttaattgtgtgagctctagccactag |
2363083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 3198349 - 3198417
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| |||||||||||| | ||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
3198349 |
tagggacattgcataatatatgcaggggttgaggttcgaaccccggacaccctacttctccacatttaa |
3198417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 4068004 - 4068072
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| | |||||||| |||||||||| || ||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
4068004 |
tagggacaatgcatattttatgcagggggcgaggttcgaaccccggacaccccacttctccacatttaa |
4068072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 10943748 - 10943784
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10943748 |
tattatatgcaggggccggggttcgaaccccggacac |
10943784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 18597431 - 18597522
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| | |||| |||| ||||||||||| |||||||||||| ||| |||| |||||||| |
|
|
| T |
18597431 |
tagggatattgcatattatatataggggttggggttcgacccccagacacctcacttctcc-tatttaaaatgtgtgagctctagccactagg |
18597522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 77 - 121
Target Start/End: Complemental strand, 33433962 - 33433918
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| |||||||| |
|
|
| T |
33433962 |
atattgcatattatatacaggggccggggttcgaactccggacac |
33433918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 81 - 144
Target Start/End: Original strand, 33909036 - 33909100
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgt |
144 |
Q |
| |
|
||||| ||||||| || || |||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
33909036 |
tgcattttatatgtagaggtcggggttcgaaccccggacacccaacttctccacatttaaaatgt |
33909100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 75 - 161
Target Start/End: Original strand, 2474786 - 2474873
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| ||| | ||||| | || ||||||| |||||||| |||| || ||||||||||| |
|
|
| T |
2474786 |
ggatattgcatattacatgcaggggccaaggttcgaactctggacatcccatttctccatatttaaaacgtgcaagctctaaccacta |
2474873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 4153569 - 4153660
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| ||||||| | ||| ||||||| ||| ||||||||| ||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
4153569 |
tagggatattgcattttatatgtatgggttggggttcgaacttcggacactctacttctccacaattaaattgtgtgagctctagccactag |
4153660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 6414090 - 6414180
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| || || ||||| | || ||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
6414090 |
tagggatattgcatattatatgca-gggtcggggttcgaatcctggacattccatttctccacaattaaattgtgtgagctctagccactag |
6414180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 16891368 - 16891459
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| |||||| |||||| | ||||| || |||| ||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
16891368 |
tagggatattgcattttatatacaggggttgaggttcgaatcccgaacactccacttctccacaattaaattgtgtgagctctagccactag |
16891459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 162
Target Start/End: Original strand, 18756012 - 18756099
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||| |||| ||||||||||| | |||||||| ||||||||||||| || ||||| ||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
18756012 |
gatatcgcattttatatgcaggagtcggggttcgaaccccggacactccatttctctacaattaaattgtgtgagttctagccactag |
18756099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 22229007 - 22228936
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||| ||| ||||||||| |||||||| ||| ||||| |||| |
|
|
| T |
22229007 |
ggatattgcatgttatatgcaggggtcggagttcgaactccggacactccacttctctacaattaaattgtg |
22228936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 25472631 - 25472541
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaa-ccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||| | | ||||||||| ||||||||||| |||||||||||| | ||| |||| ||| |||| |||||| |
|
|
| T |
25472631 |
tagggatattgcatattatatgcagagatc-gggttcaaacccccggacactccacttctccacaataaaattgtgtgagctctagccacta |
25472541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 134
Target Start/End: Original strand, 35241422 - 35241480
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||| |||||| |||||||||||| |
|
|
| T |
35241422 |
gatattgcatattatatgcaggggtcggggttcgaa-ccctgacactccacttctccaca |
35241480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 36735893 - 36735956
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| |||| ||||| |||||| |||||||||||| |
|
|
| T |
36735893 |
tagggatattgcatattatatgtaggggtcggagttcgaaccctagacactccacttctccaca |
36735956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 37034828 - 37034879
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||| |||| ||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
37034828 |
tagggatatcgcattttatatgcaggagccggagttcgaaccccggacactc |
37034879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 73 - 139
Target Start/End: Complemental strand, 37636907 - 37636840
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||| | ||||||||||| | ||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
37636907 |
agggacattgcataatttatgcaggggctgaggttcaaaccccgtatacctcacttctccacatttaa |
37636840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 38696713 - 38696802
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| ||||||||||||| || |||||||| ||||| ||||||| ||||||| ||||||| ||||||| ||| |||| ||||||| |
|
|
| T |
38696713 |
tagggatattacatattatatgcaatgg-cggggttcgaaccctggacactccacttcttcacattt-aaatgtgtgagctctatccactag |
38696802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 41477406 - 41477355
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||| ||||||| |||||| |
|
|
| T |
41477406 |
tagggatatcgcattttatatgcaggggctggggttcgaaccccgaacactc |
41477355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 76 - 145
Target Start/End: Complemental strand, 1269211 - 1269141
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||| |||||| | |||||||||||| ||||| |||| |
|
|
| T |
1269211 |
gatattgcatattatatgcaggggccaaagttcgaacctcggacaccccacttctccacaattaaattgtg |
1269141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 121 - 163
Target Start/End: Original strand, 6167284 - 6167326
Alignment:
| Q |
121 |
ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
6167284 |
ctcacttctccacatttaaaatgtgtgagctctagccactagg |
6167326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 163
Target Start/End: Original strand, 7443379 - 7443453
Alignment:
| Q |
90 |
tatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||| | ||||||||||||||| |||||| ||| || |||||||||| |
|
|
| T |
7443379 |
tatgcaggggcaggggttcgaacccttgacaccccacttctccacatttataatgtgtgagctccaaccactagg |
7443453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 9069256 - 9069346
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||| ||||||||| |||||||||||| ||| |||| ||| ||| |||||| | ||||||||| ||||| |||| ||| ||||||||||| |
|
|
| T |
9069256 |
taggaatattgcattttatatgcagggttcggagttcgaactccgaacactctatttctccacaattaaactgtgtgagctctaaccacta |
9069346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 104 - 173
Target Start/End: Original strand, 11795547 - 11795617
Alignment:
| Q |
104 |
ggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
11795547 |
ggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
11795617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 76 - 145
Target Start/End: Original strand, 12355829 - 12355899
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||| ||||||||||||| ||| |||| ||||||| ||||| ||||| |||||| ||||| |||| |
|
|
| T |
12355829 |
gatattgcattttatatgcaggggtcggagttcgaaccccgaacactccacttttccacaattaaattgtg |
12355899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 18026872 - 18026786
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||| ||||||||| |||||||| ||||| |||||||||| | | ||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
18026872 |
gatattgtatattatatataggggccgaggttcgaaccccggactccccacttctccacaattaaattgtgtgagctctagccacta |
18026786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 73 - 123
Target Start/End: Original strand, 20191462 - 20191511
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||| ||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
20191462 |
agggataatgcat-ttatatgcaggggtcggggttcgaaccccggacactc |
20191511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 76 - 141
Target Start/End: Complemental strand, 28236590 - 28236524
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaa |
141 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||| | |||| |||| |||||||||||||||| |
|
|
| T |
28236590 |
gatattgcatattatatgcagggatcagggttcaaacttcagacacctcatttctccacatttaaaa |
28236524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 37182565 - 37182638
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||| |||||||||||||||| | |||||||| || ||| |||||| |||||||||||| ||||| |||| |
|
|
| T |
37182565 |
tagggatatcgcatattatatgcaggagtcggggttcgaaaccc-gacactccacttctccacaattaaattgtg |
37182638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 39800078 - 39800004
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| | |||||| | ||||||||||| |||| || |||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
39800078 |
tagggacaatgcataatttatgcaggggcaggggctcgaacccctgacaccccacttctccacatttaaaatgtg |
39800004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 42455457 - 42455419
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
42455457 |
tattatatgcaggggccggagttcgaaccccggacactc |
42455419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 75 - 108
Target Start/End: Original strand, 18815373 - 18815406
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
18815373 |
ggatattgcatattatatgcaggcgccggggttc |
18815406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 30209040 - 30208975
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| ||||||||||||| |||||||| |||| ||| || | |||||||||| |||||||||||| |
|
|
| T |
30209040 |
tgcattttatatgcaggggtcggggttcgaacctcgggcaccccacttctccatatttaaaatgtg |
30208975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 144
Target Start/End: Original strand, 32623419 - 32623488
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgt |
144 |
Q |
| |
|
||||||||||||||||| |||||| || ||||| ||| ||||||| | || |||||||| |||||||||| |
|
|
| T |
32623419 |
gatattgcatattatatacaggggtcgaggttcgaactccggacaccccatttctccacgtttaaaatgt |
32623488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 73 - 114
Target Start/End: Original strand, 34729492 - 34729533
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccc |
114 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
34729492 |
agggataatgcatattatatgcaggggtcggggttcgaaccc |
34729533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 80 - 140
Target Start/End: Complemental strand, 39234779 - 39234718
Alignment:
| Q |
80 |
ttgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
||||||||| |||||||||| |||| ||| ||||||||||| | ||||||||||| |||||| |
|
|
| T |
39234779 |
ttgcatattttatgcaggggtcgggattcgaaccccggacaccccacttctccacgtttaaa |
39234718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 123
Target Start/End: Original strand, 39780826 - 39780878
Alignment:
| Q |
70 |
gctagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||| |||| || ||||||||||| |
|
|
| T |
39780826 |
gctagggatattgcattttatatgcaagggccggagttcgaa-cccggacactc |
39780878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 40361627 - 40361578
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| ||| |||||||| |
|
|
| T |
40361627 |
tagggatattgcatattatatgcaagggttggggttcgaactccggacac |
40361578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 108
Target Start/End: Original strand, 1670416 - 1670452
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
1670416 |
tagggatatggcatattatatgcaggggtcggggttc |
1670452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 4674878 - 4674842
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
4674878 |
tattatatgcaggggtcggggttcgaaccccggacac |
4674842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 6447543 - 6447507
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
6447543 |
tattatatgcaggggccggggttcgaacctcggacac |
6447507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 6614101 - 6614065
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
6614101 |
tattatatgcaggggccggggttcgaacctcggacac |
6614065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 7143436 - 7143504
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||| |||||||||||| ||| || |||| ||||||||||| ||||||||| |||| |||| |
|
|
| T |
7143436 |
tagggatattgtatattatatgcacaggctggagttcgaaccccggacacctcacttcttcacaattaa |
7143504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 8015867 - 8015903
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
8015867 |
tattacatgcaggggccggggttcgaaccccggacac |
8015903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 8571823 - 8571883
Alignment:
| Q |
80 |
ttgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaa |
139 |
Q |
| |
|
||||||| | |||||||||| |||||||| ||||||| |||| | |||||||||||||||| |
|
|
| T |
8571823 |
ttgcataatttatgcaggggtcggggttcgaaccccgaacaccctacttctccacatttaa |
8571883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 140
Target Start/End: Original strand, 16745104 - 16745172
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| |||| ||| || |||| | |||||||||||| ||||| |
|
|
| T |
16745104 |
agggatattgcatattatatgtaggggtcggagttcgaactccagacaccccacttctccacaattaaa |
16745172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 155
Target Start/End: Original strand, 18473829 - 18473913
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaa |
155 |
Q |
| |
|
||||||||||| |||||||||||||||| | || ||| ||||||| | | | || ||||||| |||||||||||| ||| ||||| |
|
|
| T |
18473829 |
tagggatattgtatattatatgcaggggtcaggattctaaccccgaatatcccatttctccatatttaaaatgtgtgagctctaa |
18473913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 20719760 - 20719852
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||| ||||||| ||||| | | |||| |||| || ||| || |||||||| || ||||| |||| ||| ||||||||||||| |
|
|
| T |
20719760 |
tagggatattgcattttatatgtaggggtcagagttcgaacctcgaacattccacttctccgcaattaaattgtgtgagctctaaccactagg |
20719852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 23292465 - 23292397
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| |||| |||||| | |||||||||||| |||| |
|
|
| T |
23292465 |
tagggatattgcatgttatatgcagggtttggggttcgaacctcggacaccccacttctccacaattaa |
23292397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 172
Target Start/End: Original strand, 24132991 - 24133079
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||| | | |||||||||||| ||||| |||| ||| |||| ||||||| | |||||| |
|
|
| T |
24132991 |
tattatatgcaggggccggggttcgaaccttggataccccacttctccacaattaaattgtgtgagctctagtcactaggctacttgac |
24133079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 113
Target Start/End: Complemental strand, 26065484 - 26065444
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaacc |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
26065484 |
agggatattgcatattatatgcaggggttggggttcgaacc |
26065444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 90 - 145
Target Start/End: Original strand, 26902661 - 26902717
Alignment:
| Q |
90 |
tatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| || ||||||| ||| |||||||| |
|
|
| T |
26902661 |
tatgcaggggtcggggttcgaaccccggacactccatttctccatattaaaaatgtg |
26902717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 27219626 - 27219590
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
27219626 |
tattatatgcatgggccggggttcaaaccccgtacac |
27219590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 31250167 - 31250215
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
31250167 |
agggataatgcacaatatgtgcaggggccggggttcgaaccccggacac |
31250215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 32158477 - 32158441
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
32158477 |
tattatatgcaggggccggggttcgaaccccgaacac |
32158441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 33800925 - 33800961
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
33800925 |
tattatatgcaggggccggggttcgaaccccagacac |
33800961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 163
Target Start/End: Original strand, 33999086 - 33999174
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||| ||| ||||||| ||||| ||||||| ||||||||||||| || ||||||||| ||||| | || ||| |||| |||||||| |
|
|
| T |
33999086 |
gatattacattttatatgtaggggttggggttcgaaccccggacactccatttctccacagttaaattatgtgagttctagccactagg |
33999174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 34436870 - 34436914
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccg |
116 |
Q |
| |
|
|||||| | |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
34436870 |
tagggacaatgcataatatatgcaagggccggggttcaaaccccg |
34436914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 36045197 - 36045161
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
36045197 |
tattatatgcaggggtcggggttcgaaccccggacac |
36045161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 38503332 - 38503284
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
38503332 |
agggataatgcacaatatgtgcaggggccggggttcgaaccccggacac |
38503284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 38618744 - 38618708
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
38618744 |
tattatatgcaagggccggggttcgaaccccggacac |
38618708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 40276490 - 40276422
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggac-actcacttctccacatttaa |
139 |
Q |
| |
|
|||| |||||||||||||||||||||||| | | ||| |||||||||| | |||||||||||| |||| |
|
|
| T |
40276490 |
taggaatattgcatattatatgcaggggctgagattcgaaccccggacgccccacttctccacaattaa |
40276422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 42366955 - 42367043
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactca-cttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||| ||||||| || || | |||||||| ||||||||||| |||||||||| ||||| ||| ||| |||||||||||| |
|
|
| T |
42366955 |
ggatattgcattttatatgtagaggttgaggttcaaattccggacactcaacttctccacaattaaattgtatgagctctaaccactag |
42367043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 42801504 - 42801468
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
42801504 |
tattatatgcaggggtcggggttcgaaccccggacac |
42801468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 43227886 - 43227934
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
43227886 |
agggataatgcacaatatgtgcaggggccggggttcgaaccccggacac |
43227934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 224)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 30057244 - 30057346
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
30057244 |
tagggatattgcatattatatgcaggggtcggggttcaaaccccggacaccccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
30057343 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
30057344 |
acc |
30057346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 1458066 - 1457974
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
1458066 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactagg |
1457974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 11375937 - 11375854
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||| ||| |||| |
|
|
| T |
11375937 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaaatgtgtgagctcta |
11375854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 8965116 - 8965218
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||| ||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
8965116 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctctacaattaaattgtgtgagctctaaccactaggctacttg |
8965215 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
8965216 |
acc |
8965218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 43147432 - 43147330
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
43147432 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
43147333 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
43147332 |
acc |
43147330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 43596917 - 43597019
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
43596917 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
43597016 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
43597017 |
acc |
43597019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 46775078 - 46774976
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
46775078 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
46774979 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
46774978 |
acc |
46774976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 12582076 - 12581975
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
12582076 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
12581977 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
12581976 |
ac |
12581975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 22230482 - 22230381
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||| ||| ||||| |||| ||| | ||||||||||||| |||| |
|
|
| T |
22230482 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctcaacaattaaattgtgtgagctttaaccactaggttacttg |
22230383 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
22230382 |
ac |
22230381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 9761137 - 9761228
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |||||||||||| ||||||||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
9761137 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctaaccactag |
9761228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 2222561 - 2222663
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
2222561 |
tagggatattgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
2222660 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
2222661 |
acc |
2222663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 3036103 - 3036001
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
3036103 |
tagggatattgcatattatatgcaggggccgaggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
3036004 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
3036003 |
acc |
3036001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 3847703 - 3847805
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| | ||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
3847703 |
tagggatattgcatattatatgcaggagccggggttcgatccccggacactccacttctccacaattaaattgtgtgagttctagccactaggctacttg |
3847802 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
3847803 |
acc |
3847805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 6371136 - 6371238
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||| |||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
6371136 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttcttcacaattaaattgtgtgagctctagccactaggctacttg |
6371235 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
6371236 |
acc |
6371238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 36132251 - 36132353
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
36132251 |
taggaatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgaggtctaaccactaggctacttg |
36132350 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
36132351 |
acc |
36132353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 49901504 - 49901606
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | | |||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
49901504 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccgcttctccacaattaaattgtgtgagctctagccactaggctacttg |
49901603 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
49901604 |
acc |
49901606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 55251399 - 55251297
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||| ||| | |||| |
|
|
| T |
55251399 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccaccaggctacttg |
55251300 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
55251299 |
acc |
55251297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 627030 - 626929
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| | || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
627030 |
tagggatattgcatattatatgcaagagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
626931 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
626930 |
ac |
626929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 76 - 163
Target Start/End: Original strand, 47890721 - 47890809
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||| |||||| |||||||||||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
47890721 |
gatattgcatattatatgcaggggtcggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctaaccactagg |
47890809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 77 - 172
Target Start/End: Complemental strand, 52731482 - 52731386
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
52731482 |
atattgcatattatatgcaggagccggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
52731386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 53572375 - 53572283
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||| || || |||| ||| |||||||||||| |
|
|
| T |
53572375 |
tagggatattgcatattatatgcaggagccgggattcaaaccccggacactccacttctccacaatttaattgtgtgagcgctaaccactagg |
53572283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 21935499 - 21935590
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| | || ||||||| |
|
|
| T |
21935499 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctttagccactag |
21935590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 47934120 - 47934029
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||| || || |||| ||| |||| ||||||| |
|
|
| T |
47934120 |
tagggatatggcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactag |
47934029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 75 - 173
Target Start/End: Complemental strand, 50457759 - 50457660
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||| |||||||||||| || || |||||||| | || |||||||| | ||||||| |
|
|
| T |
50457759 |
ggatattgcatattatatgcaggggccagggttcgaaccccggacactccacttctccacaatttaattgtgcgagctgtagccactaggctacttgacc |
50457660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 55021576 - 55021667
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| |||||||||||| ||||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
55021576 |
taggaatattgcatattatatgcaggggtcggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccactag |
55021667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 75 - 156
Target Start/End: Complemental strand, 5179927 - 5179845
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaac |
156 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||||| |
|
|
| T |
5179927 |
ggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaac |
5179845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 17617028 - 17616954
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
17617028 |
tagggatattgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtg |
17616954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 46105557 - 46105631
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
46105557 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
46105631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 76 - 172
Target Start/End: Original strand, 10402467 - 10402564
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| ||||||||||| |||||||||||||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
10402467 |
gatattgcatattatatgcaggggtcggagttcgaaccccggacacctcacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
10402564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 160
Target Start/End: Original strand, 18360515 - 18360604
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||||||||| |
|
|
| T |
18360515 |
tagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctaaccact |
18360604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 81 - 145
Target Start/End: Original strand, 28715721 - 28715786
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28715721 |
tgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacatttaaaatgtg |
28715786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 160
Target Start/End: Complemental strand, 36602414 - 36602325
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||||||||| |
|
|
| T |
36602414 |
tagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctaaccact |
36602325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 42231534 - 42231635
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| | |||| |
|
|
| T |
42231534 |
taggaatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagtcactaggctacttg |
42231633 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
42231634 |
ac |
42231635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 48569224 - 48569123
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
48569224 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
48569125 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
48569124 |
ac |
48569123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 49757332 - 49757231
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
49757332 |
taggaatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
49757233 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
49757232 |
ac |
49757231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 637121 - 637213
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| | | |||| |||||||| |
|
|
| T |
637121 |
taggaatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgtgctctagccactagg |
637213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 29771347 - 29771284
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||| |
|
|
| T |
29771347 |
tagggatattgcatattatatgcaggggccggggttcgaaccccgggcactccacttctccaca |
29771284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 30305830 - 30305913
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
30305830 |
tgcattttatatgcaggggctggggttcgaaccccggacacctcacttctccacatttaaaatgtgtgagctccagccactagg |
30305913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 36099222 - 36099139
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
36099222 |
tgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactagg |
36099139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 73 - 163
Target Start/End: Original strand, 40486464 - 40486554
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| ||||||||||||| ||||||| ||||||| ||||||| ||| |||| |||||||| |
|
|
| T |
40486464 |
agggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttcacattt-aaatgtgtgagctctagccactagg |
40486554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 45112159 - 45112076
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||| | ||||| |||| ||| |||| |
|
|
| T |
45112159 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgagctcta |
45112076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 56088002 - 56087911
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| || |||||||| | |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
56088002 |
tagggatattgcattttatatgcaggggccggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagttctagccactag |
56087911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 4958604 - 4958514
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| | || ||| | ||||||||| |
|
|
| T |
4958604 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattatgtgagctttaaccacta |
4958514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 76 - 173
Target Start/End: Complemental strand, 7686306 - 7686208
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| | ||||||| |
|
|
| T |
7686306 |
gatattgcattttatatgcaggggccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccattaggctacttgacc |
7686208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 13578513 - 13578439
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||| | |||||||||||| ||||| |||| |
|
|
| T |
13578513 |
tagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtg |
13578439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 25235845 - 25235743
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| |||||| |||||||||||| || || |||| ||| |||| | |||||| | |||| |
|
|
| T |
25235845 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagttctagctactaggctacttg |
25235746 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
25235745 |
acc |
25235743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 26868371 - 26868472
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| ||||||||||||| |||||||||||| ||||| |||| ||| | || |||||||| | |||| |
|
|
| T |
26868371 |
tagggatattgcatattatatgcaggagcc-gggttcgaaccccggacactccacttctccacaattaaattgtgtgagctttagccactaggctacttg |
26868469 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
26868470 |
acc |
26868472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 37868611 - 37868525
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||| || |||| |||| |||||| |||||||||||||| ||||| |||| ||| ||||||||||| |
|
|
| T |
37868611 |
gatattgcatattatatgcaggggctggagttcgaacctcggacacctcacttctccacaattaaattgtgtgagctctaaccacta |
37868525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 48615520 - 48615418
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| ||||||| | |||| |
|
|
| T |
48615520 |
tagggatattgcatattatatgcagaagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagtcactaggctacttg |
48615421 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
48615420 |
acc |
48615418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 53634299 - 53634197
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||| |||| || ||| ||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
53634299 |
tagggatattgcatattatatacaggagctgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
53634200 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
53634199 |
acc |
53634197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 5305058 - 5304957
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| |||| |||| |||||||||||||||| ||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
5305058 |
taggaatatcgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
5304959 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
5304958 |
ac |
5304957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 26919516 - 26919415
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||| ||||||||| ||||||| |||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
26919516 |
tagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttcttcacaattaaattgtgtgagctctagccactaggctacttg |
26919417 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
26919416 |
ac |
26919415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 35948230 - 35948129
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
||||||||| |||| ||||||||||| |||||||||| |||||||||||||| |||||||| ||||| |||| ||| |||| |||||||| | ||||| |
|
|
| T |
35948230 |
tagggatatcgcattttatatgcaggagccggggttcgaaccccggacactccactctccacaattaaattgtgtgagctctagccactaggctacttga |
35948131 |
T |
 |
| Q |
172 |
cc |
173 |
Q |
| |
|
|| |
|
|
| T |
35948130 |
cc |
35948129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 39023197 - 39023298
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| ||||||| |||||||||||| || || |||| || |||| |||||||| | |||| |
|
|
| T |
39023197 |
tagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccacaatttaattgtgtaagttctagccactaggctacttg |
39023296 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
39023297 |
ac |
39023298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 43978030 - 43978130
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || |||| ||||| |||||||||||| || || ||| ||| ||||||||||||||| |||| |
|
|
| T |
43978030 |
tagggatattgcatattatatgcaggggtcggggttcgaa-cccgtacactccacttctccacaatttaattgtatgagctctaaccactaggttacttg |
43978128 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
43978129 |
ac |
43978130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 53376727 - 53376658
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
53376727 |
tagggatattgcatgttatatgcaagggccggggttcgaaccccggacactccacttctccacaattaaa |
53376658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 51512057 - 51511965
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||| ||||||||||||| |||||||||||| ||||| | || ||| |||| |||||||| |
|
|
| T |
51512057 |
tagggatattgcatattatatgctgtagccggggttcgaaccccggacactccacttctccacaattaaattatgtgagctctagccactagg |
51511965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 74 - 145
Target Start/End: Original strand, 55531278 - 55531350
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||| |||| |
|
|
| T |
55531278 |
gggatatcgcattttatatgcaggggccggggttcaaaccccggacactccacttctcgacaattaaattgtg |
55531350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 79 - 161
Target Start/End: Original strand, 624509 - 624592
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||| | ||||||||||| ||||||| |||||| ||||| | |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
624509 |
attgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctccacatttaaaatgtgtgagctctaaccacta |
624592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 4234333 - 4234250
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||| |||||||| ||||| |||||| ||||| |||| ||| |||| |
|
|
| T |
4234333 |
tagggatattgcatattatatgcaggagccggggttcgaacctcggacactccacttttccacaattaaattgtgtgagctcta |
4234250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 10417269 - 10417178
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| ||||||||||||||| | | |||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
10417269 |
tagggatattacatattatatgcaggagtcagggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
10417178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 13264322 - 13264231
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| ||||||||||| | ||||||| |||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
13264322 |
tagggatattgcatattatatgcaaggaccggggttcgaaccccggacaccccacttcttcacaattaaattgtgtgagctctagccactag |
13264231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 170
Target Start/End: Original strand, 20320463 - 20320562
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| ||||||||||||| |||||| ||||| || || |||| ||||||| |||||||||| |||| |
|
|
| T |
20320463 |
tagggatatcgcatattatatgcaggggccgaagttcgaaccccggacactccacttcaccacaatttaattgtgtgagatctggccactaggttacttg |
20320562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 138
Target Start/End: Complemental strand, 23924920 - 23924853
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacattta |
138 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
23924920 |
tagggacattgcataatttatgcaggggccggggttcgaaccccggacacttcacttctccacattta |
23924853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 42395249 - 42395340
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||| ||||||| | |||||||||||| ||||| |||| ||| | || ||||||| |
|
|
| T |
42395249 |
tagggatattgcatattatatgtaggggccggggttcgaactccggacaccccacttctccacaattaaattgtgtgagctttagccactag |
42395340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 77 - 163
Target Start/End: Original strand, 47929272 - 47929359
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||| || ||||| |||| |||| || | |||||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
47929272 |
atattgcatattatatgcaggggtcgaggttcgaacctcggaaaccccacttctccacatttaaaatgtgtgagctctagccactagg |
47929359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 23176760 - 23176678
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| ||||||||||||| |||||||| |||||||||||| | |||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
23176760 |
tgcattttatatgcaggggtcggggttcgaaccccggacaccccattctccacatttaaaatgtgtgagctccagccactagg |
23176678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 23705201 - 23705127
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||| ||||||| || ||||||| |||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
23705201 |
tagggatattgcatattacatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtg |
23705127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 23778873 - 23778783
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| |||||| |||| | |||||||||||| ||||| |||| ||| ||||||||||| |
|
|
| T |
23778873 |
tagggatattacatattatatgcaggggttggggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaaccacta |
23778783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 33933787 - 33933685
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||| | ||| ||||| | ||||||||||||||||| ||||| ||| | || |||||||| | |||| |
|
|
| T |
33933787 |
tagggacattgcataatatatgcaggggccggggttcgacccctggacaccccacttctccacatttaatatgtgtgagctatagccactaggctacttg |
33933688 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
33933687 |
acc |
33933685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 34353801 - 34353903
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||| || | |||||| ||||||||||| | |||||||||||| ||||| | || ||| | ||||||||||| | |||| |
|
|
| T |
34353801 |
tagggatattgcatattatatgcagaggtcagggttcgaaccccggacaccccacttctccacaattaaattatgtgagctgtaaccactaggctacttg |
34353900 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
34353901 |
acc |
34353903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 40994151 - 40994049
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||| || |||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
40994151 |
tagggatattgcatattatatgtaggagttggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
40994052 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
40994051 |
acc |
40994049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 43271765 - 43271663
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| |||||| |||| | |||||||||||| ||||| |||| ||| | || |||||||| | |||| |
|
|
| T |
43271765 |
tagggatattgcatattatatgcagggaccagggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctatagccactaggctacttg |
43271666 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
43271665 |
acc |
43271663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 77 - 154
Target Start/End: Complemental strand, 46998411 - 46998333
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
46998411 |
atattgtatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
46998333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 8848260 - 8848211
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
8848260 |
tagggatattgcatattatatacaggggccggggttcgaaccccggacac |
8848211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 37935883 - 37935984
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||| || ||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
37935883 |
tagggatattgcatattatatgcaggggctggggttcgaactccagacacaacacttctccacaatttaattgtgtgagctctagccactaggctacttg |
37935982 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
37935983 |
ac |
37935984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 40051644 - 40051745
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| |||||| |||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
40051644 |
tagggatattgcatattatatgtaggggtaggggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
40051743 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
40051744 |
ac |
40051745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 45849069 - 45849170
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||| ||||| ||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
45849069 |
tagggatattgcatattttatgcaggggctggagttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctacttg |
45849168 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
45849169 |
ac |
45849170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 73 - 140
Target Start/End: Complemental strand, 11294885 - 11294817
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
11294885 |
agggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaa |
11294817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 42134505 - 42134413
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| ||| ||||||| | |||||||||||| ||||| | || ||| |||| |||||||| |
|
|
| T |
42134505 |
tagggatattgcatattatatgcaagggtcggggttcgaactccggacaccccacttctccacaattaaattatgtgagctctagccactagg |
42134413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 43481087 - 43480996
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| || |||||||||| |||||||||||| ||||| |||| || |||| |||||||| |
|
|
| T |
43481087 |
tagggatattgcactttatatgcaggggccggggttcgaa-cccggacactccacttctccacaattaaattgtgtgaactctagccactagg |
43480996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 45139929 - 45139861
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||| ||| | ||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
45139929 |
tagggacattgtataatttatgcaggggccggggttcgaaccccggacacctcacttctccacatttaa |
45139861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 86 - 173
Target Start/End: Original strand, 48950820 - 48950908
Alignment:
| Q |
86 |
attatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
48950820 |
attatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
48950908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 138
Target Start/End: Complemental strand, 542862 - 542795
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacattta |
138 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| ||| |||||||| |||||||||||||||| |
|
|
| T |
542862 |
tagggatattgcatattgtatgcaggggctggggttcgaacttcggacactccacttctccacattta |
542795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 3815082 - 3815145
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
3815082 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggatactccacttctccaca |
3815145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 5165879 - 5165941
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
5165879 |
tagggatatcgcatattatatgcaggggccggggttcgaacccc-gacactccacttctccaca |
5165941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 70 - 121
Target Start/End: Original strand, 6930571 - 6930622
Alignment:
| Q |
70 |
gctagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
6930571 |
gctagggatattgcataatatatgcaggggccgggattcaaactccggacac |
6930622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 12504691 - 12504608
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| | || ||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
12504691 |
tagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccacaattaaattgtgtgagctcta |
12504608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 130
Target Start/End: Original strand, 19963804 - 19963863
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| ||||||| ||||||||| |
|
|
| T |
19963804 |
tagggatattgcatattatatgcaggggtcggggttcgaacctcggacacttcacttctc |
19963863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 26250669 - 26250736
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||||| || |||||||||| |||||| ||||||||| |
|
|
| T |
26250669 |
tagggacattgcataatttatgcaggggccggggttcgaatcccggacacttacttcttcacatttaa |
26250736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 158
Target Start/End: Complemental strand, 29329871 - 29329784
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
|||| |||||| || ||||||| |||||||||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||||||| |
|
|
| T |
29329871 |
taggaatattgtattttatatgtaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctaacca |
29329784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 37251135 - 37251226
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||| ||| |||||||| |||||||||||| ||||| |||| || |||| ||||||| |
|
|
| T |
37251135 |
tagggatattgcatattttatgcaggagccggggttcgaacatcggacactccacttctccacaattaaattgtgtgaactctagccactag |
37251226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 162
Target Start/End: Complemental strand, 38848168 - 38848078
Alignment:
| Q |
73 |
agggatattgcatat-tatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| | |||||||||| |||||||| ||||||||||| | ||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
38848168 |
agggatattgcataaatttatgcaggggtcggggttcgaaccccggacaccccacttctccacattt-aaatgtgtgagctctaaccactag |
38848078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 46582656 - 46582719
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| |||||| |||||| |||||||||||| |
|
|
| T |
46582656 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccagacactccacttctccaca |
46582719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 49056797 - 49056880
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||| |||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
49056797 |
tagggacattgcatattatatgcaggagccggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
49056880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 139
Target Start/End: Original strand, 51890820 - 51890887
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
51890820 |
agggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaa |
51890887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 54103612 - 54103521
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||| ||||||||| | ||||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
54103612 |
tagggatattgcatattatatgcaggggttggagttcgaaccccggatatctcacttctccacggttaaattgtgagagttctagccactag |
54103521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 2688118 - 2688219
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || | ||||| || |||||||| | || |||||||||||| ||||||| ||| |||| |||||||| | |||| |
|
|
| T |
2688118 |
tagggatattgcatattatatgcaggagctgtggttcgaatcccggacaccccatttctccacattt-aaatgtgtgagctctagccactaggctacttg |
2688216 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
2688217 |
acc |
2688219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 3764056 - 3763966
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||| |||||| || ||| |||||||||||| || || |||| ||| |||| |||||| |
|
|
| T |
3764056 |
tagggatattacatattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtgagctctagccacta |
3763966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 4700986 - 4700884
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| || | ||||||||||| | |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
4700986 |
tagggatattgtatattatatgcaggggtcggtgtccgaaccccggacatcccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
4700887 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
4700886 |
acc |
4700884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 165
Target Start/End: Complemental strand, 31852661 - 31852567
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggtt |
165 |
Q |
| |
|
||||| |||||||||||||||| ||||| ||||||| ||||||||||||| || ||||||||| || || |||| ||| |||| |||||||||| |
|
|
| T |
31852661 |
tagggttattgcatattatatgtaggggttggggttcgaaccccggacactccatttctccacaatttaattgtgtgagctctagccactaggtt |
31852567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 48825866 - 48825776
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||| | || ||||||||||| ||||||||| |||||||||||||| |||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
48825866 |
tagggatatcgaattttatatgcaggagccggggttagaaccccggacactccactctccacaattaaattgtgtgagctctaaccactag |
48825776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 49447146 - 49447244
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||| ||||||| |||||||||||| || || |||| | | |||| |||||||| | |||||| |
|
|
| T |
49447146 |
ggatattgcatattatatgtaggagccggggttcgaaccctggacactccacttctccacaatttaattgtgtgggctctagccactaggctacttgac |
49447244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 4590268 - 4590369
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||| | ||||| |||||| |||||| |||||||||||| || || |||| ||| | || |||||||| | |||| |
|
|
| T |
4590268 |
tagggatattgcatattatatacaggggctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgagctttagccactaggctacttg |
4590367 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
4590368 |
ac |
4590369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 87 - 143
Target Start/End: Complemental strand, 7513414 - 7513357
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatg |
143 |
Q |
| |
|
||||||||||||| | |||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7513414 |
ttatatgcaggggtcagggttcgaaccccggacactccacttctccacatttaaaatg |
7513357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 26347114 - 26347065
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| |||||||||||| |
|
|
| T |
26347114 |
tagggatattgcatgttatatgcaagggccggggttcgaaccccggacac |
26347065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 82 - 142
Target Start/End: Original strand, 31109292 - 31109353
Alignment:
| Q |
82 |
gcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaat |
142 |
Q |
| |
|
|||||||| |||||| ||||||||||| ||||||||||| |||| ||||||||||||||||| |
|
|
| T |
31109292 |
gcatattaaatgcagaggccggggttcgaaccccggacatctcatttctccacatttaaaat |
31109353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 32339346 - 32339395
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
32339346 |
tagggatattgcatattatatgcaagggtcggggttcaaaccccagacac |
32339395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 33530815 - 33530916
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| ||||||||| ||| |||||||||| | || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
33530815 |
tagggatattgcatattatatgtagggatcggggttcgaaccccggatactccacttctccataattgaattgtgtgagctctagccactaggctacttg |
33530914 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
33530915 |
ac |
33530916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 42218772 - 42218873
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||| ||| ||||||||| |||||||||||| || || |||| ||| | || |||||||| | |||| |
|
|
| T |
42218772 |
tagggatattgcatattatacgtaggggctggggttcgaactccggacactccacttctccacaatttaattgtgtgagctttagccactaggctacttg |
42218871 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
42218872 |
ac |
42218873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 77 - 161
Target Start/End: Original strand, 51777871 - 51777955
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| ||||||| | ||||||||||||||| ||||||| ||| |||||| |||| |
|
|
| T |
51777871 |
atattgcatattatatgcagggatcggggttcgaactccggacatcccacttctccacattt-aaatgtgtgagctctaacaacta |
51777955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 76 - 172
Target Start/End: Complemental strand, 55853152 - 55853055
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||| ||| | ||||||| |||| ||| | |||| ||| |||| |||||||| | |||||| |
|
|
| T |
55853152 |
gatattgcatattatatgcaggggccggtgttcgaaccccgaacatcccacttcttcacaattagattgtgtgagctctagccactaggctacttgac |
55853055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 79 - 139
Target Start/End: Original strand, 24704158 - 24704218
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | |||||||||| ||| |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
24704158 |
attgcataatttatgcaggggtcggagttcgaaccctggacactcacttctccacatttaa |
24704218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 33107381 - 33107469
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||| |||||||||| |||||||| |||| || |||| |||||| ||||||||||| || || |||||||| |||||||||||| |
|
|
| T |
33107381 |
ggatattgtatattatatgtgggggccggagttcgaatcccgaacactccacttctccacaatttaattgtgcgagctctaaccactag |
33107469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 76 - 163
Target Start/End: Original strand, 34618308 - 34618396
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||| |||||||| |
|
|
| T |
34618308 |
gatattgcattttatatgcaggggttggggttggaaccccggacactccacttctccacaattaaattgtgtgagccctagccactagg |
34618396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 35219548 - 35219457
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||| ||||||| | |||||||| ||||||||||||| ||||||||||| ||||| |||| || |||| |||||||| |
|
|
| T |
35219548 |
tagggatattgcatatta-atgcaggagtcggggttcgaaccccggacactccacttctccactattaaattgtgtaagctctagccactagg |
35219457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 38690686 - 38690734
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
38690686 |
agggataatgcatattatatgcaggggtcggggttcgaaccccggacac |
38690734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 43905732 - 43905800
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||| ||||||||||| | ||||||||||| ||||| |
|
|
| T |
43905732 |
tagggatattgcatgttatatgcagggatcggggttcgaaccccggacaccccacttctccacgtttaa |
43905800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 88 - 139
Target Start/End: Original strand, 45617302 - 45617354
Alignment:
| Q |
88 |
tatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
45617302 |
tatatgcaggggccggggttctaaccccggacacctcactcctccacatttaa |
45617354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 54534848 - 54534940
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| |||| |||||| | ||||||||||||||||| ||||| ||| |||| ||||||| |
|
|
| T |
54534848 |
tagggatattgcatattatatgcaaagttcggggttcgaaccacggacaccccacttctccacatttaatatgtgtgagctctaggcactagg |
54534940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 55055938 - 55056006
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaa |
139 |
Q |
| |
|
|||||| | |||||||| ||||||||||||| ||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
55055938 |
tagggacaatgcatattttatgcaggggccgaggttcgaaccccggacacgccacttctccacatttaa |
55056006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 3157265 - 3157214
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||| | |||||||| |
|
|
| T |
3157265 |
taggaatattgcatattatatgcaggggtcggggttcaaactctggacactc |
3157214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 99 - 173
Target Start/End: Original strand, 10141032 - 10141107
Alignment:
| Q |
99 |
gccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
10141032 |
gccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
10141107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 76 - 162
Target Start/End: Original strand, 12267544 - 12267631
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||| |||||| | |||||||||||||||| | |||||||||||| | || |||| ||| |||||||||||| |
|
|
| T |
12267544 |
gatattgcatattatatgtaggggctagagttcaaaccccggacaccccacttctccacaatataattgtgtgagctctaaccactag |
12267631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 70 - 160
Target Start/End: Original strand, 12763776 - 12763867
Alignment:
| Q |
70 |
gctagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
||||||||||||||||||||||| |||||| | ||||||| ||||||||||| ||||||| || | ||||| |||| ||| ||||| |||| |
|
|
| T |
12763776 |
gctagggatattgcatattatatacaggggttgaggttcaagccccggacactccacttcttcataattaaattgtgtgagctctaatcact |
12763867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 15208544 - 15208627
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||| |||| |||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
15208544 |
tagggatattgcatattatatataggaaccggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctcta |
15208627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 15604088 - 15604025
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||| ||| ||||||||||||| |||||||||||| |
|
|
| T |
15604088 |
tagggatgttgcattttatatgcaggggtcgggattcgaaccccggacactccacttctccaca |
15604025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 22788722 - 22788659
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| || |||||||| | |||||||||||| |
|
|
| T |
22788722 |
tagggatattgcatattatatgcaggggccgaggtttgaatcccggacaccccacttctccaca |
22788659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 22819430 - 22819481
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |||||| ||||||| |
|
|
| T |
22819430 |
tagggatattgcatattatatgcaggagctggggttcgaaccccagacactc |
22819481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 39696385 - 39696295
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||| ||| | | |||||| ||||||| |||||| ||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
39696385 |
tagggatattgcatattatatgtaggagtc-gggttcgaaccccgaacactctacttctccacaattaaattgtgtgagctctagccactag |
39696295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 115
Target Start/End: Original strand, 44602507 - 44602550
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaacccc |
115 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
44602507 |
tagggatattgcattttatatgcaggggccggggttcgaacccc |
44602550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 45741497 - 45741588
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| ||||||||| ||||||||||| ||||| |||| |||||| |||||| ||||| |||||| ||||| |||| || |||||||||||| |
|
|
| T |
45741497 |
taggaatattgcatgttatatgcaggagccggagttcgaaccccagacactccacttatccacaattaaattgtgtgaactctaaccactag |
45741588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 48798301 - 48798383
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||| ||||||||||||| || ||||||||| ||||| |||| ||| |||| |
|
|
| T |
48798301 |
tagggatattgcattttata-gcaggggctggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctcta |
48798383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 107
Target Start/End: Complemental strand, 55238547 - 55238512
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
55238547 |
tagggatattgcatattatatgcaggggccggggtt |
55238512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 4105749 - 4105823
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||| ||| ||||| ||||||| |||||||||||| ||||| |||| |
|
|
| T |
4105749 |
tagggatattgcattttatatgcagagaccgggattcgaaccctggacactccacttctccacaattaaattgtg |
4105823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 74 - 163
Target Start/End: Original strand, 13161771 - 13161860
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||| |||||| |||||||||| |||||||| |||||| ||||| | ||||||| ||||||||||| || ||| |||| |||||||| |
|
|
| T |
13161771 |
gggatattacatattttatgcaggggtcggggttcgaaccccagacacaccacttctc-acatttaaaatttgtgagctctagccactagg |
13161860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 15064250 - 15064160
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||| ||||||||||||||||||||| | || ||||| ||||||||| ||| |||||||||| | ||||| |||| ||| |||| |||||| |
|
|
| T |
15064250 |
taggaatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccataattaaattgtgtgagctctagccacta |
15064160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 29505783 - 29505693
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||| ||| |||||||||| ||||||||||| || |||||||||| |||||||| ||| ||||| |||| ||| |||| |||||| |
|
|
| T |
29505783 |
tagggatatcacattttatatgcagaggccggggttcgaatcccggacactccacttctcgacaattaaattgtgtgagctctagccacta |
29505693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 35207199 - 35207125
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| | | |||||| | ||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
35207199 |
tagggatattgcatattatatgcaggagtcagggttcgagtcccggacactctacttctccacaattaaattgtg |
35207125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 43512448 - 43512538
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||| |||||||||||||||||||||||| || |||||||||| | ||| | || |||| |||||||||||| ||||| | ||||||||| |
|
|
| T |
43512448 |
taggaatattgcatattatatgcaggggctggagttcaaacccggaacaccccatttcttcacatttaaaatatgcgaactttaaccacta |
43512538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 44312832 - 44312730
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| ||| |||||| ||||| || ||||||||| ||||| |||| ||| ||| |||||||| | |||| |
|
|
| T |
44312832 |
tagggatattgcattttatatgcaggggtcgggattcgaaccccaaacactccatttctccacaattaaattgtgtgagttcttgccactaggctacttg |
44312733 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
44312732 |
acc |
44312730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 55536405 - 55536502
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| |||| ||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
55536405 |
ggatattgcatattatatgcaggag-cggggtttgaaccttggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
55536502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 9692981 - 9693030
Alignment:
| Q |
73 |
agggatattgcat-attatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9692981 |
agggataatgcattattatatgcaggggccggggttcgaaccccggacac |
9693030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 132
Target Start/End: Complemental strand, 17683943 - 17683882
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctcca |
132 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||| || ||||||||| ||||||||||| |
|
|
| T |
17683943 |
tagggatattggattttatatgcaggggccggggttataatcccggacacttcacttctcca |
17683882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 17872109 - 17872209
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| | |||||| | | |||||||||| |||| || |||||||| |||| |||||||| | |||| |
|
|
| T |
17872109 |
tagggatattgcatagtatatacaggggccggggttcgagtcccggagaccccacttctccatattt-aattgtgcgagttctagccactaggctacttg |
17872207 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
17872208 |
ac |
17872209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 24455063 - 24455136
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||||||| ||| ||| | ||||||| |||||||||||| |
|
|
| T |
24455063 |
tagggatattgtatattatatgtaggggttggggttcaaaccacgggcacccgtttctccatatttaaaatgtg |
24455136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 74 - 123
Target Start/End: Complemental strand, 26885474 - 26885425
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||| |||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
26885474 |
gggataatgcacattatatgctggggccggggttcgaaccccggacactc |
26885425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 42381161 - 42381060
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |||||||| |||| | |||| | |||||||||||| ||||| |||| ||| | || |||||||| | |||| |
|
|
| T |
42381161 |
tagggatattgcatgttatatgtaggggtcggggttcgaacctcagacaccccacttctccacaattaaattgtgtgagctttagccactaggctacttg |
42381062 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
42381061 |
ac |
42381060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 43627302 - 43627241
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | |||||||||| |||||||||||||| ||||||| |||||||||| |||||| |
|
|
| T |
43627302 |
attgcataatttatgcaggggtcggggttcaaaccctggacactccacttctccatatttaa |
43627241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 71 - 139
Target Start/End: Complemental strand, 44568268 - 44568199
Alignment:
| Q |
71 |
ctagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||| ||| | |||| |||||||||||| |||||| |
|
|
| T |
44568268 |
ctagagatattgcatattatatgcaggggtcggggttcgaactcgagacacctcacttctccatatttaa |
44568199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 45126154 - 45126255
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| || | ||||| |||||| |||||| |||||||||||| || || |||| ||| | || |||||||| | |||| |
|
|
| T |
45126154 |
tagggatattgtatattatatgcaggagctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgagctttagccactaggctacttg |
45126253 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
45126254 |
ac |
45126255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 75 - 163
Target Start/End: Original strand, 46903356 - 46903444
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||| | ||||||||| |||||| |||||| ||| |||||||| |||| |
|
|
| T |
46903356 |
ggatattgcatattatatgcagggg-ttgggtttgaaccccggacaccccacttctccgcatttataatgtgtgagctctaaccattagg |
46903444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 76 - 172
Target Start/End: Original strand, 54029579 - 54029676
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||| ||||||||||| |||| |||| |||| || |||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| | |||||| |
|
|
| T |
54029579 |
gatattacatattatatgtagggaccggagttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagtcactaggctacttgac |
54029676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 56479274 - 56479226
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
56479274 |
tagggatattgcatattatatgcaggggtc-gggttcgaaccccggacac |
56479226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 5635221 - 5635257
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5635221 |
tattatatgcaggggtcggggttcaaaccccggacac |
5635257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 119
Target Start/End: Complemental strand, 12167664 - 12167616
Alignment:
| Q |
72 |
tagggatattgcatattatatgcagg-ggccggggttcaaaccccggac |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
12167664 |
tagggatattgcatattatatgcaggaggccggggttcgaactccggac |
12167616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 14149825 - 14149861
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14149825 |
tattatatgcaggggccggggttcgaaccccggacac |
14149861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 25726357 - 25726265
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||| || ||| | ||||| |||| ||||||| ||||||||||| || || |||||||| ||||||||||||| |
|
|
| T |
25726357 |
tagggatattgcatattatatacaaggggcaaggttcgaaccttagacactccacttctccacaatttaattgtgcgagctctaaccactagg |
25726265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 27103149 - 27103057
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||| || || ||| |||| || ||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
27103149 |
tagggatattgcatattatatgtagaggtcggagttcgaattccggacactccacttctccacaattaaattgtgtgagctctagacactagg |
27103057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 28520794 - 28520758
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28520794 |
tattatatgcaggggccggggttcgaaccccggacac |
28520758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 29406379 - 29406447
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | |||||||||| |||||||| ||| ||||||| | ||||||||||||||||| |
|
|
| T |
29406379 |
tagggacattgcataatttatgcaggggtcggggttcgaactccggacaacccacttctccacatttaa |
29406447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 30217621 - 30217713
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||| || ||| |||||| || ||||||||| ||||| |||| ||| | || |||||||| |
|
|
| T |
30217621 |
tagggatattgcatattatatgcaggggctagagttcgaatcccagacactccagttctccacaattaaattgtgtgagctttagccactagg |
30217713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 37310052 - 37310140
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||| ||| | ||||||| || | ||||| |||| || |||||||||||| |
|
|
| T |
37310052 |
ggatattgcatattatatgtaggggttggggttcaaaccccgtacatcccacttcttcataattaaattgtgtgaattctaaccactag |
37310140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 39697910 - 39697874
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39697910 |
tagggatattgcatattatatgcaggggtcggggttc |
39697874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 41897595 - 41897527
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||| |||||||| |||||| ||||| ||||| | ||| | ||||||||||||||||| |
|
|
| T |
41897595 |
tagggatattgcataatatatgcacgggccgaggttcgaaccctgtacaccccacttctccacatttaa |
41897527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 47018009 - 47017973
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47018009 |
tattatatgcaggggccggggttcgaaccccggacac |
47017973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 48968273 - 48968237
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48968273 |
tattatatgcaggggccggggttcgaaccccggacac |
48968237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 49763821 - 49763773
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
49763821 |
agggatattgcatattatatgcaggggtcggagttcaaacttcggacac |
49763773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 53698043 - 53698007
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53698043 |
tattatatgcaggggccggggttcgaaccccggacac |
53698007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 73 - 139
Target Start/End: Original strand, 2629602 - 2629669
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||| | |||||||||| |||||||| ||||||| |||| | |||||||||||||||| |
|
|
| T |
2629602 |
agggacattgcataatttatgcaggggtcggggttcgaaccccgaacaccccacttctccacatttaa |
2629669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 75 - 133
Target Start/End: Original strand, 2771061 - 2771120
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccac |
133 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| ||||||| |||| | |||||||||| |
|
|
| T |
2771061 |
ggatattgcatattatatgcagggaccggagttcgaaccccgaacaccctacttctccac |
2771120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 79 - 145
Target Start/End: Complemental strand, 8089292 - 8089225
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||||||||||| ||| |||| ||| |||||||| || |||||||||||||| ||||| |
|
|
| T |
8089292 |
attgcatattatatgcaggggtcggagttcgaacttcggacactccatttctccacatttaatatgtg |
8089225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 12775287 - 12775196
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| ||||||||||||| | |||||| || | ||||||| |||||||||||| ||||| |||| ||| | || ||||||| |
|
|
| T |
12775287 |
tagggatattgcattttatatgcaggggtcagggttcgaattctggacactccacttctccacaattaaattgtgtgagctttacccactag |
12775196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 138
Target Start/End: Complemental strand, 17815473 - 17815406
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacattta |
138 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| || ||| ||||| | ||||||||| ||||| |
|
|
| T |
17815473 |
tagggatattacatattatatgcaggggtcggggttcgaatccctgacaccctacttctccatattta |
17815406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 24680134 - 24680083
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| ||| || ||||||| |
|
|
| T |
24680134 |
tagggatattgcatattatatgcaggggctgaggttcgaactccagacactc |
24680083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 73 - 108
Target Start/End: Complemental strand, 29889853 - 29889818
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29889853 |
agggataatgcatattatatgcaggggccggggttc |
29889818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 111
Target Start/End: Original strand, 32037586 - 32037625
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaa |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
32037586 |
tagggataatgcatattatatgcaggggtcggggttcaaa |
32037625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 75 - 165
Target Start/End: Complemental strand, 52483222 - 52483131
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggtt |
165 |
Q |
| |
|
|||| |||||||||||||| ||| || |||||| ||| ||||| ||| ||||||||||| ||||| ||| |||| ||||||||||||||| |
|
|
| T |
52483222 |
ggatgttgcatattatatgtaggagcaggggtttgaacaccggatgctccacttctccacaattaaattgtacgagctctaaccactaggtt |
52483131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 52798300 - 52798362
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
52798300 |
tagggatattgcatattatatgca-gagtcggggttcgaaccccgtacactccacttctccaca |
52798362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 84 - 161
Target Start/End: Complemental strand, 194713 - 194635
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| ||||| |||||| || || |||| ||| |||| |||||| |
|
|
| T |
194713 |
atattatatgcaggggttggggttcgaaccccggacactccacttgtccacaatttaattgtgtgagttctagccacta |
194635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 172
Target Start/End: Complemental strand, 3297263 - 3297177
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggac-actcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| |||||||||||||| ||||| |||| || |||| | |||||||| |||||| |
|
|
| T |
3297263 |
ttatatgcaggggccggggttcgaacttcggacgcctcacttctccacaattaaattgtgtgaactctatcaactaggttacttgac |
3297177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 77 - 134
Target Start/End: Original strand, 5801982 - 5802040
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| | ||||| |||||||||||| |
|
|
| T |
5801982 |
atattgcatattatatgcaggggctggggttcgaacctcacacactccacttctccaca |
5802040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 114
Target Start/End: Complemental strand, 8144639 - 8144597
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccc |
114 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| ||||| |
|
|
| T |
8144639 |
tagggatattgcatattatatgtaggggctggggttcgaaccc |
8144597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 85 - 123
Target Start/End: Original strand, 9924888 - 9924926
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
9924888 |
tattatatgcaggggtcggggttcgaaccccggacactc |
9924926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 86 - 163
Target Start/End: Complemental strand, 17709494 - 17709416
Alignment:
| Q |
86 |
attatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||||||| |||||||| ||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
17709494 |
attatatgtaggggccggagttcgaaccccggacactccacttctctacaattaaattgtgtgagctctagtcactagg |
17709416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 172
Target Start/End: Complemental strand, 21380232 - 21380125
Alignment:
| Q |
70 |
gctagggatattgcatattatatgcaggggccg----gggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggt |
164 |
Q |
| |
|
|||||||||||||||||||||| ||||| | || |||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| ||| |||| |
|
|
| T |
21380232 |
gctagggatattgcatattataagcaggaggcggggtgggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctagccattaggc |
21380133 |
T |
 |
| Q |
165 |
tgcttgac |
172 |
Q |
| |
|
| |||||| |
|
|
| T |
21380132 |
tacttgac |
21380125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 35851749 - 35851660
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||| |||||||| |||||| ||||| ||| || |||||| |||||| ||||||||||||||||||||||||| || | ||||||| |
|
|
| T |
35851749 |
tagggacattgcataatatatgtaggggtaggg-ttagaacccctaacactcccttctccacatttaaaatgtgcgagctccagccactag |
35851660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 139
Target Start/End: Original strand, 49264566 - 49264616
Alignment:
| Q |
90 |
tatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||| ||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
49264566 |
tatgcaggggccgaggttcgaaccccggacaccccacttctccacatttaa |
49264616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 55521511 - 55521437
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| |||| ||||||||||||| || |||| ||| |||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
55521511 |
tagggacattgtatattatatgcagaggtcgggattcgaaccccaaacactccacttcttcacatttaaaatgtg |
55521437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 132
Target Start/End: Original strand, 2565100 - 2565161
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctcca |
132 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||| ||| || |||||||||| |||||||||| |
|
|
| T |
2565100 |
tagggatattacatattatatgcaggggttgggattcgaatcccggacactccacttctcca |
2565161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 162
Target Start/End: Complemental strand, 4513438 - 4513397
Alignment:
| Q |
121 |
ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
4513438 |
ctcacttctccacatttaaaatgtgtgagctctgaccactag |
4513397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 172
Target Start/End: Original strand, 21432640 - 21432737
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||| ||| || ||||| || ||||| ||| || | | ||||||| |||||||||||| ||| |||||| |||||| | |||||| |
|
|
| T |
21432640 |
gatattgcatattatatacagaggtcggggatcgaaccctggataccccatttctccatatttaaaatgtgtgagctctaactactaggctacttgac |
21432737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 101 - 161
Target Start/End: Complemental strand, 31187559 - 31187498
Alignment:
| Q |
101 |
cggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||| || ||| ||||||| |||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
31187559 |
cggggttcgaatcccagacactccacttatccacatttaaaatgtgtgagctctaaccacta |
31187498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 37719022 - 37719123
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| |||| ||||||||||||| || |||| ||| ||| ||||| |||||||||||| |||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
37719022 |
tagggatatcgcattttatatgcaggggtcgaagttcgaactccgaacactccacttctccacaagtaaattgtgtgagctctagccactaggctacttg |
37719121 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
37719122 |
ac |
37719123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 84 - 121
Target Start/End: Complemental strand, 37889670 - 37889633
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
37889670 |
atattatatgcaggggtcggggttcgaaccccggacac |
37889633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 38228459 - 38228508
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| ||| ||| |||| |
|
|
| T |
38228459 |
tagggatattgcatgttatatgtaggggccggggttcgaactccgaacac |
38228508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 168
Target Start/End: Complemental strand, 41137968 - 41137871
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgct |
168 |
Q |
| |
|
|||||| |||||||| |||||||||||| ||||||| |||| | |||| | ||||||| || ||||||||||| ||| |||| |||||||| |||| |
|
|
| T |
41137968 |
tagggacattgcataatatatgcaggggttggggttcgaaccacagacaccccacttcttcatatttaaaatgtttgagctctagccactaggctgct |
41137871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 42044087 - 42044026
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | ||||||||||||| |||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
42044087 |
attgcataatttatgcaggggccgaggtttgaaccccggacaccccacttctccacatttaa |
42044026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 44195672 - 44195604
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||| || |||||||| ||||||||||||| ||||| |
|
|
| T |
44195672 |
tagggatattgcattttatatgca-gggtcggggttcgaattccggacacttcacttctccacaattaaa |
44195604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 50512382 - 50512451
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
|||| ||||||||||||||||||||||| | ||||| |||| | |||| || ||||||||||||||||| |
|
|
| T |
50512382 |
taggaatattgcatattatatgcaggggttgaggttcgaacctctgacaccttacttctccacatttaaa |
50512451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 3465615 - 3465651
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
3465615 |
tattatatgcaggggccggagttcgaaccccggacac |
3465651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 6171017 - 6170949
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | |||| |||||| ||||||| |||| | ||||||| |||||||||||||||| |
|
|
| T |
6171017 |
tagggacattgcataatttatgtaggggctggggttcgaacctcagacactctacttctccacatttaa |
6170949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 7768851 - 7768815
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7768851 |
tattatatgcagaggccggggttcgaaccccggacac |
7768815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 8690246 - 8690282
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
8690246 |
tattatatgcaggggtcggggttcgaaccccggacac |
8690282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 10098157 - 10098193
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
10098157 |
tattatatgcaggggccgggattcgaaccccggacac |
10098193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 20753188 - 20753152
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
20753188 |
tattatatgtaggggccggggttcgaaccccggacac |
20753152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 22751041 - 22751077
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
22751041 |
tattatatgcaggggtcggggttcaaaccccgaacac |
22751077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 24234137 - 24234101
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24234137 |
tattatatgcaggggccggggtttgaaccccggacac |
24234101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 162
Target Start/End: Original strand, 28815650 - 28815724
Alignment:
| Q |
89 |
atatgcaggggccggggttcaaaccccggaca--ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||| ||| |||| | |||| | |||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
28815650 |
atatgcaggggccgggattcgaacctcagacatccccacttctccacatt-aaaatgtgtgagctctaaccactag |
28815724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 149
Target Start/End: Original strand, 29536135 - 29536210
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac--tcacttctccacatttaaaatgtgcgag |
149 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||| |||||| ||||| |||||||||||| ||||| | |||||| |
|
|
| T |
29536135 |
gatatcgcattttatatgcaggggccgaggttcgaaccccagacacctccacttctccacaattaaattatgcgag |
29536210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 140
Target Start/End: Original strand, 30263807 - 30263851
Alignment:
| Q |
97 |
gggccggggttcaaaccccggacactc-acttctccacatttaaa |
140 |
Q |
| |
|
||||||||||||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
30263807 |
gggccggggttcaaacctcggacacccaacttctccacatttaaa |
30263851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 140
Target Start/End: Complemental strand, 30288380 - 30288336
Alignment:
| Q |
97 |
gggccggggttcaaaccccggacactc-acttctccacatttaaa |
140 |
Q |
| |
|
||||||||||||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
30288380 |
gggccggggttcaaacctcggacacccaacttctccacatttaaa |
30288336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 33076562 - 33076598
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
33076562 |
tattatatgcaggggtcggggttcgaaccccggacac |
33076598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 36257726 - 36257762
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
36257726 |
tattgtatgcaggggccggggttcgaaccccggacac |
36257762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 36954169 - 36954205
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
36954169 |
tattatatgcaggggtcggggttcgaaccccggacac |
36954205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 117
Target Start/End: Original strand, 37574293 - 37574336
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccgg |
117 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
37574293 |
agggataatgcat-ttgtatgcaggggccggggttcaaaccccgg |
37574336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 81 - 121
Target Start/End: Complemental strand, 44315569 - 44315529
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||| |||| |
|
|
| T |
44315569 |
tgcatattatatgcaggagccgggattcaaaccccgaacac |
44315529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 49319425 - 49319461
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
49319425 |
tattatatgcaggggtcggggttccaaccccggacac |
49319461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 49743394 - 49743430
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
49743394 |
tattatatgcaggggccgggattcgaaccccggacac |
49743430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 53815728 - 53815764
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
53815728 |
tattatatgcaggggctggggttcgaaccccggacac |
53815764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 53921555 - 53921487
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||| ||||||||| |||||| ||||| ||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
53921555 |
taggaatattgcatgttatatataggggtcggggtttgaaccccggacaccccacttctccacatttaa |
53921487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 81 - 121
Target Start/End: Complemental strand, 54294455 - 54294415
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
54294455 |
tgcataatatatgcaaggtccggggttcaaaccccggacac |
54294415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 100
Target Start/End: Complemental strand, 54443928 - 54443900
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54443928 |
tagggatattgcatattatatgcaggggc |
54443900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 55656171 - 55656135
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
55656171 |
tattatatgcaggggccggagttcaaatcccggacac |
55656135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 9e-27; HSPs: 225)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 34102659 - 34102558
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||||| |||| |
|
|
| T |
34102659 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaactgtgtgagctctagccactaggttacttg |
34102560 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
34102559 |
ac |
34102558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 4139022 - 4139124
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
4139022 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
4139121 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
4139122 |
acc |
4139124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 17218510 - 17218612
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
17218510 |
tagggatattgcatattatatgcaagggccggggttcaaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
17218609 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
17218610 |
acc |
17218612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 18194360 - 18194462
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
18194360 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
18194459 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
18194460 |
acc |
18194462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 37800659 - 37800557
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
37800659 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
37800560 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
37800559 |
acc |
37800557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 39719957 - 39720059
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
39719957 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
39720056 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
39720057 |
acc |
39720059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 40933879 - 40933777
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
40933879 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
40933780 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
40933779 |
acc |
40933777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 41936455 - 41936353
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
41936455 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
41936356 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
41936355 |
acc |
41936353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 50496862 - 50496760
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
50496862 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
50496763 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
50496762 |
acc |
50496760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 53432785 - 53432683
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
53432785 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
53432686 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
53432685 |
acc |
53432683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 50234146 - 50234238
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
50234146 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagg |
50234238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 6920011 - 6919909
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
6920011 |
tagggatattgcatattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
6919912 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
6919911 |
acc |
6919909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 10176951 - 10176861
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
10176951 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccacta |
10176861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 165
Target Start/End: Original strand, 11436526 - 11436620
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggtt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| ||||| | |||||||||||| ||||| |||| ||| ||||||||||||||| |
|
|
| T |
11436526 |
tagggatattgcatattatatgcaggggccgtggttcgaaccctggacaccccacttctccacaattaaattgtgtgagttctaaccactaggtt |
11436620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 17608367 - 17608265
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
17608367 |
tagggatattgcatattatatgcaggggccggggttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctacttg |
17608268 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
17608267 |
acc |
17608265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 31327549 - 31327447
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
31327549 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggaaactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
31327450 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
31327449 |
acc |
31327447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 31327766 - 31327676
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
31327766 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccacta |
31327676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 37488508 - 37488406
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
37488508 |
tagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
37488409 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
37488408 |
acc |
37488406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 40548325 - 40548427
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| || ||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
40548325 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctacttg |
40548424 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
40548425 |
acc |
40548427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 47098754 - 47098844
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
47098754 |
tagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccacta |
47098844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 52974101 - 52973999
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||| || | |||| |
|
|
| T |
52974101 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactgggctacttg |
52974002 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
52974001 |
acc |
52973999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 45701366 - 45701467
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
45701366 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
45701465 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
45701466 |
ac |
45701467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 7920342 - 7920434
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |||||||||||||| ||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
7920342 |
tagggatattgcatattatatgcaagagccggggttcgaaccccggacactcaacttctccacaattaaattgtgtgagctctagccactagg |
7920434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 15975174 - 15975266
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||| |||||||| ||||||| |||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
15975174 |
tagggatattgcatattatatgcaggagccggggttcgaacctcggacactccacttcttcacaattaaattgtgtgagctctaaccactagg |
15975266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 44625264 - 44625181
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||| ||| || |||||||||| |
|
|
| T |
44625264 |
tgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgggagctccaaccactagg |
44625181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 5636847 - 5636745
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||| |||||||| ||||||||||| ||||| |||| ||| |||| ||||||| | |||| |
|
|
| T |
5636847 |
tagggatattgcatattatatgcaggagccggggttcgaaccctggacactcgacttctccacaattaaattgtgtgagctctagtcactaggctacttg |
5636748 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
5636747 |
acc |
5636745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 7269977 - 7270079
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||| ||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
7269977 |
tagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
7270076 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
7270077 |
acc |
7270079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 10482901 - 10482799
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||| ||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
10482901 |
tagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
10482802 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
10482801 |
acc |
10482799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 22501979 - 22501877
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
22501979 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
22501880 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
22501879 |
acc |
22501877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 32144606 - 32144708
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||| ||||||||||| | || ||||||||| ||||| |||| ||| |||| |||||||||| |||| |
|
|
| T |
32144606 |
taggggtattgcatattatatgcaggagccggggttcgaaccccggacaccccatttctccacaattaaattgtgtgagctctagccactaggttacttg |
32144705 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
32144706 |
acc |
32144708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 32256602 - 32256512
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
32256602 |
tagggatattgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccacta |
32256512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 33706775 - 33706673
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
33706775 |
tagggatattacatattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
33706676 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
33706675 |
acc |
33706673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 48251594 - 48251696
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
48251594 |
tagggatattgcatattatatgcaggagccggggttagaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
48251693 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
48251694 |
acc |
48251696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 49447160 - 49447234
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
49447160 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
49447234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 53163616 - 53163718
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||| | ||||||||| || ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
53163616 |
tagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccacttctccgcaattaaattgtgtgagctctagccactaggctacttg |
53163715 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
53163716 |
acc |
53163718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 73 - 161
Target Start/End: Complemental strand, 5641661 - 5641572
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||| |||| ||||| |||| ||| |||| |||||| |
|
|
| T |
5641661 |
agggatattgcatattatatgcaggggccggggttcgaacctcggacacctcacttcttcacaattaaattgtgtgagctctagccacta |
5641572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 9176634 - 9176533
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
9176634 |
tagggatattgcatattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccagtaggctacttg |
9176535 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
9176534 |
ac |
9176533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 3894569 - 3894657
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| ||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
3894569 |
ggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactag |
3894657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 17729016 - 17729104
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
17729016 |
ggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactag |
17729104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 19030245 - 19030333
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
19030245 |
ggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactag |
19030333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 53577977 - 53578069
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||| |||||||||||||||| | |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
53577977 |
tagggatgttgcatattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagg |
53578069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 79 - 173
Target Start/End: Original strand, 14795140 - 14795235
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||||||||||||| | ||||||||||||||||||||||| ||| || ||||||| || | ||||||| |
|
|
| T |
14795140 |
attgcataatatatgcaggtgccagggttcaaaccccggacaccccacttctccacatttaaaatgtgtgagctccaaccactcggctacttgacc |
14795235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 27329971 - 27329888
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
27329971 |
tgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactagg |
27329888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 70 - 145
Target Start/End: Original strand, 44106622 - 44106696
Alignment:
| Q |
70 |
gctagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||| ||||||||| |||||||||||| ||||| |||| |
|
|
| T |
44106622 |
gctagggatattgcatattatatgcaggggccgtgattcaaa-cccggacacccacttctccacaattaaattgtg |
44106696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 51879126 - 51879209
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
51879126 |
tgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactagg |
51879209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 52410289 - 52410198
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
52410289 |
tagggatattgcatattatatgcaggagccgggattcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccactag |
52410198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 2522948 - 2523050
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| | || |||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
2522948 |
tagggatattgcatattatatgcaagagctggggtttgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
2523047 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
2523048 |
acc |
2523050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 3748650 - 3748548
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| ||||||||||| |||||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
3748650 |
tagggatattgtatattatatgcaggggttggggttcgaaccccggacatctcacttctccacaatttaattgtgtgagctctagccactaggctacttg |
3748551 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
3748550 |
acc |
3748548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 8964824 - 8964722
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| ||| ||| ||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
8964824 |
tagggatattgcatatcatatgcaggagccggggttcgaactccgaacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
8964725 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
8964724 |
acc |
8964722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 34898815 - 34898713
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| |||||| |||| | |||||||||||| ||||| |||| ||| |||| ||||||| || |||| |
|
|
| T |
34898815 |
tagggatattgcatattatatgcaggggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctagccactagattacttg |
34898716 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
34898715 |
acc |
34898713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 28689720 - 28689619
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| || || |||| ||| ||| |||||||| | |||| |
|
|
| T |
28689720 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctggccactaggctacttg |
28689621 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
28689620 |
ac |
28689619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 52945917 - 52946017
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || |||| ||||| |||||||||||| || || ||| ||| ||||||||||||||| |||| |
|
|
| T |
52945917 |
tagggatattgcatattatatgcaggggtcggggttcgaa-cccgtacactccacttctccacaatttaattgtatgagctctaaccactaggttacttg |
52946015 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
52946016 |
ac |
52946017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 77 - 172
Target Start/End: Complemental strand, 2007126 - 2007030
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
2007126 |
atattgcatattatatgcaggagtcggggtttgaaccccggacactccacttctccacaattaaattgtgtgagctctatccactaggctacttgac |
2007030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 6488146 - 6488238
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| |
|
|
| T |
6488146 |
tagggatattgcatattatatgcaggggctagggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactagg |
6488238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 159
Target Start/End: Complemental strand, 17602724 - 17602636
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||| |
|
|
| T |
17602724 |
tagggatattgcatattatatgtaggggccgaggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccac |
17602636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 77 - 172
Target Start/End: Complemental strand, 19591622 - 19591526
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |||||||||| | ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
19591622 |
atattgcatattatatgtaggagccggggttcgaaccccggacactccacttctccataattaaattgtgagagctctagccactaggctacttgac |
19591526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 81 - 172
Target Start/End: Complemental strand, 25884027 - 25883935
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||| |||||||||||| |||||||| ||||||||||| | ||||||||||||||||||||||| ||| || | |||||||| | |||||| |
|
|
| T |
25884027 |
tgcataatatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactaggctacttgac |
25883935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 30779615 - 30779523
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| ||||| | |||||||||||| || || |||| ||| |||| |||||||| |
|
|
| T |
30779615 |
tagggatattgcatattatatgcaggggtcggggttcgaaccctggacaccccacttctccacaatttaattgtgtgagttctagccactagg |
30779523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 31529006 - 31528914
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| ||| ||| |||| |||||||| |
|
|
| T |
31529006 |
tagggatattgaatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtatgagctctagccactagg |
31528914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 42108230 - 42108138
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggac-actcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| |||||||||| | |||||||||||| ||||| |||| ||| ||| ||||||||| |
|
|
| T |
42108230 |
tagggatattgcatattatatgcagaggccgggtttcgaaccccggacgccccacttctccacaattaaattgtgtgagttcttaccactagg |
42108138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 42268806 - 42268898
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||| || |||||||||| |||||||||||| || || ||| |||| ||||||||||||| |
|
|
| T |
42268806 |
tagggatattgcatattatatgcaggggccagagtttgaatcccggacactccacttctccacaatttaattgtacgagctctaaccactagg |
42268898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 171
Target Start/End: Original strand, 45198745 - 45198845
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||| | ||||| |||| | ||||||| ||||||||||| ||||| |||| ||| |||| |||||||| |||||| |
|
|
| T |
45198745 |
tagggatattgcatattatatgtaggggctgaggttcgaacctcagacactctacttctccacaattaaattgtgtgagctctagccactaggctgcttg |
45198844 |
T |
 |
| Q |
171 |
a |
171 |
Q |
| |
|
| |
|
|
| T |
45198845 |
a |
45198845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 45551857 - 45551765
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||| ||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
45551857 |
tagggatatcgcattttatatgtaggggccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagg |
45551765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 158
Target Start/End: Original strand, 13331872 - 13331959
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||||||||| |||||||||| ||||||||| |||||||||||| ||| ||| |||| |
|
|
| T |
13331872 |
tagggatattgcatattatatgcatgtgtcggggttcaaattccggacactcaacttctccatatttaaaatgtgtgagctctcacca |
13331959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 15085723 - 15085640
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||||| |||||||||||| |||||||||||| ||| || | |||||||| |
|
|
| T |
15085723 |
tgcattttatatgcaggggtcggggttcgaaccccggacacctcacttctccatatttaaaatgtgtgagctccagccactagg |
15085640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 19996500 - 19996417
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
19996500 |
tagggatattgcatattatatgcaggagttggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctcta |
19996417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 41710614 - 41710697
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| ||| |||||||||||||||||| || ||||||||| |||||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
41710614 |
tgcattttacatgcaggggccggggttcgaatcccggacacctcacttctccacatttaaaatgtgtgagctccagccactagg |
41710697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 46767374 - 46767457
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||||||||| | ||||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
46767374 |
tgcattttatatgcaggggctgaggttcaaaccccggacatcccacttctccacatttaaaatgtgtgagctccagccactagg |
46767457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 48739792 - 48739701
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |||||| |||| | |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
48739792 |
tagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaactgtgtgagctctagccactag |
48739701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 54349888 - 54349825
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||| |||||| |||||||||||||| |
|
|
| T |
54349888 |
tagggatattgcatattatatgcaggggtcggagttcaaacctcggacacctcacttctccaca |
54349825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 4200633 - 4200559
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||| ||||||| | ||||||||| ||||| |||| |
|
|
| T |
4200633 |
tagggatattgcatattatatgcaggggtcggggttcgaaccccagacactcaatttctccacaattaaattgtg |
4200559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 73 - 142
Target Start/End: Complemental strand, 16675319 - 16675249
Alignment:
| Q |
73 |
agggatattgcatatt-atatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaat |
142 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| |||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
16675319 |
agggatattgcatatttatatgcaagggccggagttcgaaccccggacacccacttctccacgtttaaaat |
16675249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 30555275 - 30555173
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||| ||||| | || |||| || ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
30555275 |
tagggatattgcatattaaatgcaagagcaggggatcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
30555176 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
30555175 |
acc |
30555173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 33225396 - 33225306
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||| |||| ||||||||||| |||||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
33225396 |
tagggatatcgcattttatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccacta |
33225306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 33606987 - 33606886
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||||||| | |||||| ||||||||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
33606987 |
tagggatattgcattttatatgcaggggtc-gggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
33606889 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
33606888 |
acc |
33606886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 76 - 161
Target Start/End: Original strand, 48546199 - 48546285
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| ||||||||||| |||||||||| ||| ||||| |||| ||| ||||||||||| |
|
|
| T |
48546199 |
gatattgcatattatatgtagggatcggggttcgaaccccggacacctcacttctctacaattaaattgtgtgagctctaaccacta |
48546285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 81 - 162
Target Start/End: Complemental strand, 49028982 - 49028900
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||||||| ||||| ||||||||||||||||||||| | ||| || ||||||||| |
|
|
| T |
49028982 |
tgcattttatatgcagggaccggggttcgaaccccgaacactccacttctccacatttaaaatgcgtgagctccaaccactag |
49028900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 50659612 - 50659702
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| ||||||||||||| |||||||| ||| ||||| |||| ||| |||| |||||| |
|
|
| T |
50659612 |
tagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctcgacaattaaattgtgtgagctctagccacta |
50659702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 4640528 - 4640427
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |||| || ||||| ||||||| |||| ||||| |||| ||| ||||| ||||||| | |||| |
|
|
| T |
4640528 |
tagggatattgcatattatatgcaggagctggggttcgaacctcgaacactccacttcttcacaattaaattgtgtgagctctaatcactaggctacttg |
4640429 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
4640428 |
ac |
4640427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 19999889 - 19999990
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| ||||||| | ||||||||| || || |||| ||| |||| ||||||| | |||| |
|
|
| T |
19999889 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactctagttctccacaatttaattgtgtgagttctagtcactaggctacttg |
19999988 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
19999989 |
ac |
19999990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 25938978 - 25938877
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| ||||| |||||||||| | || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
25938978 |
tagggatattgcatattatatgcaggggctggggttcgaaccccacacactccacttctccataatttaactgtgtgagctctagccactaggctacttg |
25938879 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
25938878 |
ac |
25938877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 81 - 161
Target Start/End: Original strand, 35200586 - 35200667
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||| ||||||| || || |||||||||||||||||||| |||| |||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
35200586 |
tgcattttatatgtagaggtcggggttcaaaccccggacacctcatttctccacatttaaaatgtgtgagttttaaccacta |
35200667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 46795977 - 46795876
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||| | ||||| || ||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
46795977 |
tagggatattgcattttatatgcaggggccggggttcgaaccctgaacactccatttctccacaattaaattgtgtgagctctagccattaggctacttg |
46795878 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
46795877 |
ac |
46795876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 73 - 161
Target Start/End: Original strand, 48722267 - 48722356
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||| | | ||||| ||| ||||| |||| ||| |||| |||||| |
|
|
| T |
48722267 |
agggatattgcatattatatgcaggggtcggggttcgaaccccggacaccctatttctctacaattaaattgtgtgagctctagccacta |
48722356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 53752748 - 53752647
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||| ||||||||||||||||||| || |||| ||||| ||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
53752748 |
tagggatatggcatattatatgcaggggcaggagttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctacttg |
53752649 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
53752648 |
ac |
53752647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 882411 - 882503
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||| | ||||| ||||| |||||| || || |||| ||| ||||||||||||| |
|
|
| T |
882411 |
tagggatattgcatattatatgcaggagctggggttcgaaccctgaacactccacttttccacaatttaattgtgtgagttctaaccactagg |
882503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 4860186 - 4860274
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||| |||||| |||| | |||||||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
4860186 |
ggatattgcattttatatgcaggggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaaccactag |
4860274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 19550528 - 19550620
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| || | |||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
19550528 |
tagggatattgcatattatatgcaggagcttgtgttcgaaccccgtacactccacttctccacaattaaattgtgtgagttctagccactagg |
19550620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 40192178 - 40192246
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||||||||||||| || ||| |||| || |||||||||| ||||||||||||||||| |
|
|
| T |
40192178 |
tagggatattgcatattatatgcagaggtcggtgttcgaatcccggacactccacttctccacatttaa |
40192246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 52434715 - 52434623
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||| ||| || |||||||| ||||||||||||| |||||||| ||| || || || | ||| ||||||||||||| |
|
|
| T |
52434715 |
tagggatattgcatattatatacagaggacggggttcgaaccccggacactccacttctcaacaatttaattgagtgagctctaaccactagg |
52434623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 81 - 172
Target Start/End: Original strand, 53906410 - 53906502
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||| |||||| |||||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
53906410 |
tgcattttatatgcaggggccggggtttgaaccccggacacttcacttttccacaattaaattgtgtgagctctagccactaggctacttgac |
53906502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 54769878 - 54769810
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |||| |||||| | ||||||||||||||||| |
|
|
| T |
54769878 |
tagggatattgcatattatatgcaggtgccggagttcgaaccacggacaccccacttctccacatttaa |
54769810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 2368958 - 2369009
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| ||||||| |
|
|
| T |
2368958 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactc |
2369009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 2390402 - 2390319
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||| |||||||||||||| | ||||||||| ||||| |||| ||| |||| |
|
|
| T |
2390402 |
tagggatattgcatattatatgcaggagctagggttcgaaccccggacactcaatttctccacaattaaattgtgtgagctcta |
2390319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 11820026 - 11820117
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| ||||||| ||| | |||||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
11820026 |
tagggatattgcatgttatatgtaggagtcggggttcgaaccccggaaactccacttctccacaattaaattgtgtgagctctagccactag |
11820117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 139
Target Start/End: Complemental strand, 19222633 - 19222566
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
19222633 |
agggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaa |
19222566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 154
Target Start/End: Complemental strand, 22472358 - 22472279
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
22472358 |
gatattgcatattatatgcaagagccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctcta |
22472279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 139
Target Start/End: Original strand, 24303413 - 24303480
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
24303413 |
agggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaa |
24303480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 29373494 - 29373423
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| | |||| | |||||||||||| ||||| |||| |
|
|
| T |
29373494 |
ggatattgcatattatatgcaggggccggggttcgaacctcagacaccccacttctccacaattaaattgtg |
29373423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 29559722 - 29559631
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||| ||| ||||||| | |||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
29559722 |
tagggatattgcatattatatgtagaggtcggggtttgaacttcggacaccccacttctccacatttaaaatgtgtgagttctatccactag |
29559631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 31586969 - 31587052
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| || |||||||| | |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
31586969 |
tagggatattgcatattatatgcaggggtcggagttcgaatcccggacaccccacttctccacaattaaattgtgtgagctcta |
31587052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 162
Target Start/End: Original strand, 34847619 - 34847705
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| ||||| |||| ||||||||||||||||| | ||||| ||| |||||||||||| |
|
|
| T |
34847619 |
gatattgcatattatatgcatgggccggtgttcgaaccctagacatctcacttctccacattt-atatgtgtgagttctaaccactag |
34847705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 36834753 - 36834702
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
36834753 |
tagggatattgtatattatatgcaggggtcggggttcaaactccggacactc |
36834702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 41253788 - 41253705
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| ||| ||||||| |||| |||||||||||| ||| || | |||||||| |
|
|
| T |
41253788 |
tgcattttatatgcaggggccggggttcgaaccccgaacacctcacttttccatatttaaaatgtgtgagctccagccactagg |
41253705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 138
Target Start/End: Complemental strand, 44652030 - 44651963
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacattta |
138 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| ||||||||| | | |||||||||||||||| |
|
|
| T |
44652030 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggataccccacttctccacattta |
44651963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 45871039 - 45871090
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
45871039 |
tagggatattgtatattatatgcaggggtcggggttcgaaccccggacactc |
45871090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 163
Target Start/End: Complemental strand, 49443470 - 49443380
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||| | |||||||||||||| |||| ||||||||||| | ||||||||||||||| ||||||| ||| |||| |||||||| |
|
|
| T |
49443470 |
agggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccacattt-aaatgtgtgagctctagccactagg |
49443380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 52984032 - 52984115
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||||||| |||||| ||| |||||||| ||||||||||||| |||||||| ||| ||||| |||| ||| |||| |
|
|
| T |
52984032 |
tagggatattgcatattgtatgcaagggtcggggttcgaaccccggacactccacttctctacaattaaattgtgtgagctcta |
52984115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 53347338 - 53347275
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| |||||| |||||| |||||||||||| |
|
|
| T |
53347338 |
tagggatattgcatattatatgcagggactggggttcgaaccccagacactccacttctccaca |
53347275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 148
Target Start/End: Complemental strand, 1743845 - 1743767
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc-aaaccccggacact-cacttctccacatttaaaatgtgcga |
148 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| || ||||||||||| |||||||| ||| ||||| ||||||| |
|
|
| T |
1743845 |
tagggatattgcattttatatgtaggggccggggttcgaacccccggacactccacttctcgacagttaaattgtgcga |
1743767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 13638293 - 13638191
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||||| |||||| |||||| |||||||||||| || || |||| ||| | || |||||||| | |||| |
|
|
| T |
13638293 |
tagggatattacatattatatgtaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctatagccactaggctacttg |
13638194 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
13638193 |
acc |
13638191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 74 - 163
Target Start/End: Complemental strand, 40910226 - 40910136
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| | |||||| |||||| |||||||||||| ||| | |||| ||| |||| |||||||| |
|
|
| T |
40910226 |
gggatattgcatattatatgcaggggctgaggtccgaaccccagacactccacttctccacaattatattgtgtgagctctagccactagg |
40910136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 44364043 - 44364133
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||| || | | |||| ||||||||| || ||||| | ||||||||||||||| || | |||||||||| |
|
|
| T |
44364043 |
tagggatattgcatattatatgcagaggtctgagttcgaaccccggatacccactttttcacatttaaaatgtgtgaactttaaccactag |
44364133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 49194740 - 49194650
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||| ||||||||||||||||| ||||| | |||||| |||||||||||| ||||||||||||| || || |||| ||| |||| |||||| |
|
|
| T |
49194740 |
taggaatattgcatattatatgtaggggtcagggttcgaaccccggacacttcacttctccacaatttaattgtgtgagctctagccacta |
49194650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 49750454 - 49750380
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| || || |||| | ||||||| ||||||||||||||| |
|
|
| T |
49750454 |
tagggatattgcatattatatgcaggggctggggttcgaattccagacaccccacttcttcacatttaaaatgtg |
49750380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 132
Target Start/End: Original strand, 8125661 - 8125722
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctcca |
132 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| || |||||||||| ||||||||| |
|
|
| T |
8125661 |
tagggatattgcatattatatgcagggaccggggttcgaattccggacactctacttctcca |
8125722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 76 - 172
Target Start/End: Original strand, 14887256 - 14887353
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||| ||||| | ||||| |||||||||||| || || ||| ||| |||| |||||||||| |||||| |
|
|
| T |
14887256 |
gatattacatattatatgcaggggtcggggttcgaaccctgtacactccacttctccacaatttaattgtatgagctctagccactaggttacttgac |
14887353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 20489837 - 20489886
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
20489837 |
tagggttattgcatattatatgcaggggccggagttcgaaccccggacac |
20489886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 160
Target Start/End: Complemental strand, 25279107 - 25279018
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| || ||||||||||| | |||||||||||| ||||| |||| ||| |||| ||||| |
|
|
| T |
25279107 |
tagggatattgtatattatatgtaggggccgggatttgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccact |
25279018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 26942775 - 26942876
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||| | |||| | |||||||| ||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
26942775 |
tagggatattgcatattatatgcaggggccagggttcgaaccgcagacaccccacttctctacaattaaattgtgtgagctctagccattaggctacttg |
26942874 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
26942875 |
ac |
26942876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 77 - 145
Target Start/End: Original strand, 30185074 - 30185142
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||| |||||||| |||||||||||| ||||| |||| |
|
|
| T |
30185074 |
atattgcatattatatgcaggggtc-gggttcaaacctcggacactccacttctccacaattaaattgtg |
30185142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 81 - 141
Target Start/End: Original strand, 34102097 - 34102158
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaa |
141 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||||||||||| |||| |||||||||||||||| |
|
|
| T |
34102097 |
tgcattttatatgcaggggctggggttcgaaccccggacacctcatttctccacatttaaaa |
34102158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 34847565 - 34847614
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||| |||||||| |
|
|
| T |
34847565 |
tagggatattgcatattatatgcaggggtcggggttcgaactccggacac |
34847614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 4880194 - 4880282
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||| |||||||||| ||| | ||||| |||||| ||||| | ||||||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
4880194 |
ggatattgcattttatatgcagtggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaaccactag |
4880282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 160
Target Start/End: Original strand, 19866495 - 19866582
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||| |||| ||| |||| ||||| |
|
|
| T |
19866495 |
tagggatattgcattttatatgtaggggttggggttcaaaccccagacac-aacttctccacaattaaattgtgtgagctctagccact |
19866582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 87 - 123
Target Start/End: Complemental strand, 22432972 - 22432936
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22432972 |
ttatatgcaggggccggggttcaaaccccggacactc |
22432936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 79 - 162
Target Start/End: Complemental strand, 23653257 - 23653174
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||||||| ||| ||||||| |||||| |||||||||| ||| |||| ||||||| |
|
|
| T |
23653257 |
attgcataatatatgcaggggtcggggttcgaaccccgaacacctcacttatccaca-ttaaaatgtgtgagctctagccactag |
23653174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 76 - 163
Target Start/End: Original strand, 23954870 - 23954958
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| | ||||| ||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
23954870 |
gatattgcatattatatgcaggggttgaggttcaaaccccggacattgcacttttccactattaaattgtgtgagctctagccactagg |
23954958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 131
Target Start/End: Original strand, 32776233 - 32776293
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctcc |
131 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
32776233 |
tagggacattgcataatttatgcaggggccggggttcgaaccccggacacctcacttctcc |
32776293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 38949696 - 38949764
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||||| ||||||| ||| | ||||||||||||||||| |
|
|
| T |
38949696 |
tagggacattgcataatttatgcaggggccggggttcgaaccccgaacaccccacttctccacatttaa |
38949764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 73 - 140
Target Start/End: Original strand, 43280091 - 43280159
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||| || |||||||| | |||||||||||||||||| |
|
|
| T |
43280091 |
agggacattgcataatttatgcaggggccggggttcgaatcccggacaccccacttctccacatttaaa |
43280159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 52309158 - 52309090
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||| |||||||||| | |||||||| |||||| |||| | ||||||||||||||||| |
|
|
| T |
52309158 |
tagggatattgcatactatatgcaggagtcggggttcgaaccccagacaccccacttctccacatttaa |
52309090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 142
Target Start/End: Complemental strand, 7938344 - 7938273
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaat |
142 |
Q |
| |
|
|||||||||| ||| ||||||| ||||| |||||||| |||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
7938344 |
tagggatattacattttatatgtaggggtcggggttcgaaccccagacactccacttctccacaattaaaat |
7938273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 138
Target Start/End: Original strand, 23939056 - 23939123
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacattta |
138 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
23939056 |
tagggatattacatattatatgcagaggttggggttcgaaccccggacactctacttcttcacattta |
23939123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 28193820 - 28193871
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| | |||||||||||||| |
|
|
| T |
28193820 |
tagggatattgcattttatatgcaggggtcggggtacgaaccccggacactc |
28193871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 51425862 - 51425945
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| ||||| |||||| ||||||||| ||| ||||| |||| ||| |||| |
|
|
| T |
51425862 |
tagggatatcacattttatatgcaggggccggggttcgaaccctggacacttcacttctcgacaattaaattgtgtgagctcta |
51425945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 4541920 - 4542021
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||| ||||| |||||| |||||||||||| || || |||| || |||| |||||||| | |||| |
|
|
| T |
4541920 |
tagggatattgtatattatatgcaggggctggggttc-gaccccagacactccacttctccacaatttaattgtgtgaactctagccactaggctacttg |
4542018 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
4542019 |
acc |
4542021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 69 - 123
Target Start/End: Original strand, 6447049 - 6447103
Alignment:
| Q |
69 |
agctagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| | |||||| |||||||||||||| |
|
|
| T |
6447049 |
agctagggatattgtatattacatgcaggggtcagggttcgaaccccggacactc |
6447103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 19879223 - 19879313
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||| | ||| |||||||||||||||||||||| ||||||| ||| | ||||||| |||| ||||| |||| ||| |||| |||||| |
|
|
| T |
19879223 |
tagggatactacattttatatgcaggggccggggttcgaaccccgaacaccccacttcttcacaattaaattgtgtgagctctagccacta |
19879313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 32732585 - 32732511
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||| ||| ||||||||| |||||||||| | ||||| |||| |
|
|
| T |
32732585 |
tagggatatcgcattttatatgcaggggtcggggttcgaactccggacactccacttctccataattaaattgtg |
32732511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 94 - 163
Target Start/End: Complemental strand, 36478214 - 36478144
Alignment:
| Q |
94 |
caggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||||||||||||| |||||||| ||| || | |||||||| |
|
|
| T |
36478214 |
caggggccggggttcgaacctcggacatctcacttctccacattaaaaatgtgtgagctccagccactagg |
36478144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 40723708 - 40723634
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||| |||||||| | ||| ||||||| |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
40723708 |
tagggatattgcatgttatatgcggaggctggggttcgaaccttagacacctcacttctccacatttaaaatgtg |
40723634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 80 - 173
Target Start/End: Original strand, 46754558 - 46754652
Alignment:
| Q |
80 |
ttgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||||||||||||| ||| ||| ||||||||||| || | ||||||||| ||||| |||| ||| |||| ||||||||| ||||||| |
|
|
| T |
46754558 |
ttgcatattatatgcaggggtcggatttcgaaccccggacaccttatttctccacagttaaattgtgtgagctctagtcactaggttacttgacc |
46754652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 54626365 - 54626455
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||| |||| ||||||| ||| | |||||||| |||||||||||||| |||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
54626365 |
tagggatatcgcattttatatgtaggagtcggggttcgaaccccggacactccactctccacaattaaattgtgtgagctctagccactag |
54626455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 9220300 - 9220211
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||| | || ||||||||||| | |||||||| |||||||||||||| |||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
9220300 |
tagggatatcgtattttatatgcaggagtcggggttcgaaccccggacactccactctccacaattaaattgtgtgagctctagccacta |
9220211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 11206012 - 11206113
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||| || |||||| | | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
11206012 |
tagggatattgcatattatatgtagaggttggggttcgaatcccggataccccacttctccacagttaaattgtgtgagctctagccactaggctacttg |
11206111 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
11206112 |
ac |
11206113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 113
Target Start/End: Complemental strand, 11250639 - 11250598
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaacc |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
11250639 |
tagggatattgcatattatatgcagggtccggggttcgaacc |
11250598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 28550367 - 28550318
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||| |||||||| |
|
|
| T |
28550367 |
tagggatattgcatattatatgcaggggccgaagttcgaactccggacac |
28550318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 76 - 121
Target Start/End: Original strand, 29098718 - 29098763
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
29098718 |
gatattgtatattatatgcaggggtcggggttcgaaccccggacac |
29098763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 75 - 120
Target Start/End: Complemental strand, 40963756 - 40963711
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca |
120 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
40963756 |
ggatattgcattttatatgcaggggtcggggttcgaaccccggaca |
40963711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 42920695 - 42920594
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| |||| |||| ||||||||||||| ||||||| |||||| |||||| |||||||||||| ||||| |||| ||| ||| |||||||| | |||| |
|
|
| T |
42920695 |
taggaatatcgcattttatatgcaggggttggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctggccactaggctacttg |
42920596 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
42920595 |
ac |
42920594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 44764744 - 44764810
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
44764744 |
tagggacattgcataatttatgcaggggc--gggttcgaaccccggacactccacttctccacatttaa |
44764810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 78 - 123
Target Start/End: Original strand, 44827137 - 44827182
Alignment:
| Q |
78 |
tattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||| |||||||||||||||| | |||||||||||||| |
|
|
| T |
44827137 |
tattgcatattaaatgcaggggccggggtacgaaccccggacactc |
44827182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 48515433 - 48515364
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||| |||| | |||||||||| || ||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
48515433 |
tagggatattccataatttatgcaggggtcgaggttcgaaccccggacaccacacttctccacatttaaa |
48515364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 50675790 - 50675689
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||| |||||| | ||||| ||| | ||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
50675790 |
tagggatattgcatattatatacaggggttgtggttcgaactctggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
50675691 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
50675690 |
ac |
50675689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 51155140 - 51155039
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| |||||| |||||||||| |||||| ||||||| |||| | ||||| | ||||||||||| ||||| |||| ||| |||||| |||||| | |||| |
|
|
| T |
51155140 |
taggaatattggatattatatgtaggggctggggttcgaacctccgacaccccacttctccacaattaaattgtgtgagctctaactactaggctacttg |
51155041 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
51155040 |
ac |
51155039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 113
Target Start/End: Original strand, 51772911 - 51772952
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaacc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
51772911 |
tagggatattgcatattatatgcaggggtcggggttcgaacc |
51772952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 9625015 - 9625051
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9625015 |
tattatatgcaggggccggggttcgaaccccggacac |
9625051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 172
Target Start/End: Original strand, 10349439 - 10349523
Alignment:
| Q |
89 |
atatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||| | |||| ||| |||| ||||||||| ||||||||||| ||||| |||| ||| ||||||||||||| | |||||| |
|
|
| T |
10349439 |
atatgcaggagtcgggtttcgaacctcggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
10349523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 15492113 - 15492205
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||| || |||| | ||||||| ||||| |||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
15492113 |
tagggatattgcattttatatgaaggggctgggatttaaacactggacactccacttttccacaattaaattgtgtgagctctagccactagg |
15492205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 24751323 - 24751287
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24751323 |
tattatatgcaggggccggggttcgaaccccggacac |
24751287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 76 - 163
Target Start/End: Complemental strand, 25638433 - 25638345
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||| ||||| || ||||| ||| |||||||||| ||||||| ||| ||||| |||| ||| |||| ||| |||| |
|
|
| T |
25638433 |
gatattgcatattatatgtaggggtcgaggttcgaacaccggacactcaacttctctacaattaaattgtgtgagctctagccaatagg |
25638345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 27183744 - 27183708
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27183744 |
tattatatgcaggggccggggttcgaaccccggacac |
27183708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 87 - 171
Target Start/End: Original strand, 27668959 - 27669043
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
||||||||| | | |||||||| |||||||||||||| |||||||| ||||| |||| ||| |||| |||||||||| ||||| |
|
|
| T |
27668959 |
ttatatgcaagagtcggggttcgaaccccggacactccactctccacaattaaattgtgtgagctctagccactaggttacttga |
27669043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 143
Target Start/End: Complemental strand, 28396830 - 28396758
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatg |
143 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| | |||| |||| | ||||||||||| |||||||| |
|
|
| T |
28396830 |
tagggatattgcatgttatatgcaggggtcggggttcgtatcccgaacacgctacttctccacaattaaaatg |
28396758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 39425830 - 39425794
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39425830 |
tattatatgcaggggtcggggttcaaaccccggacac |
39425794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 41411671 - 41411607
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||| | ||||||||| |||||||||||||||||||| | | ||||||||||||||| |
|
|
| T |
41411671 |
gatattgcataatttatgcagggttcggggttcaaaccccggacaccccgcttctccacatttaa |
41411607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 75 - 162
Target Start/End: Complemental strand, 45513040 - 45512952
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||| |||| | |||||| |||| || ||||| |||||||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
45513040 |
ggatattgcatattatatacaggagttggggtttgaaccacgaacactacacttctccacaattaaattgtgtgagctctaaccactag |
45512952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 140
Target Start/End: Complemental strand, 46845018 - 46844950
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaa |
140 |
Q |
| |
|
||||| |||||||| | |||||||||| ||| |||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
46845018 |
agggacattgcataatttatgcaggggtcggagttcgaaccccggacaccctacttctccacatttaaa |
46844950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 47098538 - 47098606
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||| ||| | ||||||||||||| ||||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
47098538 |
tagggacattgtataatttatgcaggggccgaggttcgaaccccagacacctcacttctccacatttaa |
47098606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 52030153 - 52030189
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52030153 |
tattatatgcaggggccggggttcgaaccccggacac |
52030189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 1697896 - 1697805
Alignment:
| Q |
72 |
tagggatattgcatatt-atatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||||||||| ||||| | ||||||||| | ||||| |||| ||| ||| ||||||| |
|
|
| T |
1697896 |
tagggatattgcatatttatatgcaggggtcagggttcaaaccctggacaccccacttctccttaattaaattgtgtgagctctgaccacta |
1697805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 131
Target Start/End: Complemental strand, 5326080 - 5326025
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctcc |
131 |
Q |
| |
|
|||||||||||||| ||||| | || |||||| |||||||||||||||||||||| |
|
|
| T |
5326080 |
gatattgcatattacatgcatgagcaagggttcgaaccccggacactcacttctcc |
5326025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 12894578 - 12894495
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||| ||||||| || ||||||||||| ||| |||| || ||||||||||||| ||||| |||| ||| |||| |
|
|
| T |
12894578 |
tagggatattgcattttatatgtagaggccggggttcgaacttcggatacttcacttctccacaattaaattgtgtgagctcta |
12894495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 82 - 121
Target Start/End: Complemental strand, 14271993 - 14271954
Alignment:
| Q |
82 |
gcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
14271993 |
gcatattatatgcaggggccggagttcgaaccccggacac |
14271954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 38819371 - 38819281
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||||| |||||| ||||| |||||||||||| || || |||| ||| |||| ||||||| |
|
|
| T |
38819371 |
tagggatatttcatattatatgcagggactggggttctaacccc-aacactccacttctccacaatttaattgtgtgagctctagccactag |
38819281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 123
Target Start/End: Original strand, 39169788 - 39169834
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
39169788 |
gatattgcatat-atatgcaggggccggggttcgaaccccgaacactc |
39169834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 39966122 - 39966059
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| |||| | |||||| |||||||||||| |
|
|
| T |
39966122 |
tagggatattgcatattatatgcaggggttgaggttcgaacctcagacactccacttctccaca |
39966059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 46880019 - 46880070
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||||| ||||||| |||||| |
|
|
| T |
46880019 |
tagggatattgcattttatatgcagaggccgaggttcgaaccccgaacactc |
46880070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 8762128 - 8762054
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||||| |||| ||||| | |||||||||||| ||||| |||| |
|
|
| T |
8762128 |
tagggatattacatattatatgcaggtgtcggggttcgaaccatggacaccccacttctccacaattaaattgtg |
8762054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 16886604 - 16886678
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||| |||||||| | |||| | ||||| ||||| ||||||||||| |
|
|
| T |
16886604 |
tagggacattgcatattgtatacaggggccgggattcaaacctcagacaccccacttttccacgtttaaaatgtg |
16886678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 19882707 - 19882796
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| ||| ||||| ||| ||| | |||||||||||||| |||||||| ||| | ||||||||| |
|
|
| T |
19882707 |
tagggatattgcatgttatatgcattggccgaggt-caaactccgaacatcccacttctccacattaaaaatgtgtgagctataaccacta |
19882796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 121
Target Start/End: Original strand, 24537861 - 24537895
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
24537861 |
ttatatgcaggggccggggttcgaaccccggacac |
24537895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 75 - 121
Target Start/End: Complemental strand, 25954839 - 25954793
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||| |||| ||||||| |
|
|
| T |
25954839 |
ggatatcgcatattatatgcaggggccgaggttcgaacctcggacac |
25954793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 75 - 140
Target Start/End: Complemental strand, 31673294 - 31673229
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || ||| ||||| |||||||||||| ||||| |
|
|
| T |
31673294 |
ggatattgcatattatatgcaggagccggggttcgaatccc-aacactccacttctccacaattaaa |
31673229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 114
Target Start/End: Original strand, 34740309 - 34740351
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccc |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
34740309 |
tagggatattgcatattatatgcatgggccagggttcgaaccc |
34740351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 77 - 162
Target Start/End: Original strand, 36666488 - 36666573
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||| |||||||||||||||||| | ||| |||||| ||||| | ||||||||||||||| ||||| ||| |||||||||||| |
|
|
| T |
36666488 |
atattgtatattatatgcaggggcccga-ttcgaaccccagacaccccacttctccacatttataatgtatgagctctaaccactag |
36666573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 76 - 161
Target Start/End: Original strand, 36741197 - 36741283
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||| |||| |||||||||| || | |||||||||| | || | || |||||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
36741197 |
gatattacataatatatgcaggagctgaggttcaaacctcagatattctacttctccacatttaaaatgtgtgagttttaaccacta |
36741283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 73 - 162
Target Start/End: Complemental strand, 40739258 - 40739168
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| |||| ||||||||||||||||| |||||| ||| ||||||| ||||||||||| ||||||||||| ||| |||| ||||||| |
|
|
| T |
40739258 |
aggggtattacatattatatgcaggggtttgggttcgaacttcggacacctcacttctccatgtttaaaatgtgtgagctctagccactag |
40739168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 44764617 - 44764516
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| | |||||||||||||| | ||| |||||| |||||| |||||||||| | || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
44764617 |
tagggatattgcatttcatatgcaggggccgagattcgaacccc-gacactccacttctccataatttaattgtgtgagctctagccactaggctacttg |
44764519 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
44764518 |
acc |
44764516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 75 - 162
Target Start/End: Complemental strand, 46176847 - 46176758
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca--ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||| | |||| ||||||||||| | || |||||||||||||||||||| || |||| ||||||| |
|
|
| T |
46176847 |
ggatattgcatattatatgcagggattagagttcgaaccccggacacccccatttctccacatttaaaatgtgtgaattctagccactag |
46176758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 121
Target Start/End: Complemental strand, 46328985 - 46328951
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
46328985 |
ttatatgcaggggccggggttcgaaccccggacac |
46328951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 5174051 - 5173990
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | ||||||||||| ||||||| ||||||| ||| | ||||||||||||||||| |
|
|
| T |
5174051 |
attgcataatttatgcaggggcaggggttcgaaccccgaacaccccacttctccacatttaa |
5173990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 145
Target Start/End: Original strand, 10828501 - 10828566
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||| | |||| |||| |||||| |||| | |||||||||||||| |||||||| |
|
|
| T |
10828501 |
tgcatattatatgcagagaccggagttcgaaccccagacaccccacttctccacattaaaaatgtg |
10828566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 140
Target Start/End: Original strand, 13018815 - 13018880
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
||||||||||||||||||||||||| | ||||| || || ||| ||| |||||||||||| ||||| |
|
|
| T |
13018815 |
gatattgcatattatatgcaggggctgaggttcgaatcctggatactccacttctccacaattaaa |
13018880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 14644878 - 14644812
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| ||| ||||||| ||||| |||||||||| ||||| |
|
|
| T |
14644878 |
tagggatattgcattttatatgcaggggtcggaattcgaaccccgaacact--cttctccacaattaaa |
14644812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 73 - 145
Target Start/End: Complemental strand, 19132321 - 19132248
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||| |||| | |||||||||| |||||||||||| |
|
|
| T |
19132321 |
agggctattgcatattatatgcattgaccggggttcaaacctaagacaccccacttctccatatttaaaatgtg |
19132248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 118
Target Start/End: Original strand, 20244166 - 20244199
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccgga |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
20244166 |
tattatatgcaggggccggggttcgaaccccgga |
20244199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 24559408 - 24559457
Alignment:
| Q |
73 |
agggatattgcata-ttatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
24559408 |
agggataatgcataattatatgcaggggtcggggttcgaaccccggacac |
24559457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 172
Target Start/End: Original strand, 25833849 - 25833945
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| |||| || ||||| ||||| |||||| ||||| |||| ||| |||| ||||||| | |||||| |
|
|
| T |
25833849 |
gatattgcatattatatgcaggag-cggggttcgaacctcgaacactccacttatccacaattaaattgtgtgagctctagtcactaggctacttgac |
25833945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 161
Target Start/End: Original strand, 27983882 - 27983967
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||||| |||||| || ||||||||| ||||| ||| ||| |||| |||||| |
|
|
| T |
27983882 |
atattgcattttatatgcaggggtcggggtttgaaccccagacactccaattctccacaattaaattgtatgagctctagccacta |
27983967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 161
Target Start/End: Original strand, 31922383 - 31922467
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || ||| |||| ||||||||||||| ||||| || | ||| |||| |||||| |
|
|
| T |
31922383 |
atattgcatattatatgcaggagccggggttcgaatccc-aacacttcacttctccacaattaaattgcgtgagctctagccacta |
31922467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 32828463 - 32828564
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || | |||| || ||| |||||| ||||| |||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
32828463 |
tagggatattgcatattatatgcaggagctgaggtttgaatcccagacactccacttttccacaattaaattgtgtgagctctagccattaggctacttg |
32828562 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
32828563 |
ac |
32828564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 161
Target Start/End: Original strand, 52575490 - 52575574
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||| ||||||||||||| || | ||| |||||| ||||| ||||||||||||| ||||| | || ||| ||||||||||| |
|
|
| T |
52575490 |
atattgcattttatatgcagggg-cgtgattcgaaccccagacacttcacttctccacaattaaattatgtgagctctaaccacta |
52575574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 166808 - 166856
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||||| | ||||||||||||||||||| |||||| ||||| |
|
|
| T |
166808 |
agggataatgcataatttatgcaggggccggggttcgaaccccagacac |
166856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 552193 - 552237
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccg |
116 |
Q |
| |
|
||||||||||||||| |||||||| || || |||||||||||||| |
|
|
| T |
552193 |
tagggatattgcataatatatgcaaggtccagggttcaaaccccg |
552237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 140
Target Start/End: Original strand, 9685019 - 9685087
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
||||| |||||||| | ||||||||||| ||||||| || |||| ||||| |||||||||| ||||||| |
|
|
| T |
9685019 |
agggacattgcataatttatgcaggggctggggttcgaatcccgaacactccacttctccatatttaaa |
9685087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 163
Target Start/End: Original strand, 10350585 - 10350625
Alignment:
| Q |
123 |
cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
10350585 |
cacttctccacatttaaaatgtatgagctctaaccactagg |
10350625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 13644748 - 13644712
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
13644748 |
tagggatattgtatattatatgcaggggtcggggttc |
13644712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 14868717 - 14868753
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
14868717 |
tattatatgcaggggccggggttcgaaccccgaacac |
14868753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 77 - 121
Target Start/End: Original strand, 15491880 - 15491924
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||| ||||| |
|
|
| T |
15491880 |
atattgcatattatatgcaggggttggggttcgaaccccagacac |
15491924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 77 - 160
Target Start/End: Complemental strand, 17472373 - 17472289
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
||||||||||||||||||||| || ||| ||| |||| |||| ||| || ||||||||| ||||| |||| ||| |||| ||||| |
|
|
| T |
17472373 |
atattgcatattatatgcaggagctgggattcgaacctcggatactccaattctccacaattaaattgtgtgagctctagccact |
17472289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 121 - 161
Target Start/End: Original strand, 23327867 - 23327907
Alignment:
| Q |
121 |
ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
23327867 |
ctcacttctccatatttaaaatgtgtgaggtctaaccacta |
23327907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 87 - 123
Target Start/End: Complemental strand, 24160589 - 24160553
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
24160589 |
ttatatgcaggggtcggggttcgaaccccggacactc |
24160553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 33206789 - 33206825
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
33206789 |
tattatatgcaggggctggggttcgaaccccggacac |
33206825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 36331789 - 36331753
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
36331789 |
tattatatgcaggggtcggggttcgaaccccggacac |
36331753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 159
Target Start/End: Complemental strand, 36625219 - 36625131
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| ||| ||| ||||| ||||||| ||| ||||| |||| ||| |||| |||| |
|
|
| T |
36625219 |
tagggatattgcatattatatgcaggagttggggttcgaactccgaacactccacttctttacagttaaattgtgtgagctctagccac |
36625131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 75 - 123
Target Start/End: Complemental strand, 38562214 - 38562166
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||| |||||| ||||||| |
|
|
| T |
38562214 |
ggatattgcatattatatgcaggagtcggagttcgaacccctgacactc |
38562166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 41121903 - 41121939
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
41121903 |
tattatatgcagaggtcggggttcaaaccccggacac |
41121939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 108
Target Start/End: Complemental strand, 42541861 - 42541829
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
42541861 |
gatattgcatattatatgcaggggccgaggttc |
42541829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 45647325 - 45647393
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||| ||| ||||||||||| |||||||| ||||||||||| ||||||||| || |||||| |
|
|
| T |
45647325 |
tagggacattgtataaaatatgcagggggcggggttcgaaccccggacacctcacttcttcatatttaa |
45647393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 49146116 - 49146152
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
49146116 |
tattatatgcaggggtcggggttcgaaccccggacac |
49146152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 49375729 - 49375661
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||| ||| |||| | ||||||||||| || |||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
49375729 |
tagggacattacataatttatgcaggggctggcgttcgaaccccggacactccacttcaccacatttaa |
49375661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 52670201 - 52670109
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||| || | || ||||| ||||||| |||| ||||||||||| | |||| |||| ||| |||| |||||||| |
|
|
| T |
52670201 |
tagggatattgcatattatatgtagaagtcgaggttcgaaccccgaacacttcacttctccataattaatttgtgtgagctctagccactagg |
52670109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 77 - 140
Target Start/End: Original strand, 53753648 - 53753712
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaa |
140 |
Q |
| |
|
||||| |||||||||||||| || ||| ||| ||||||||| || ||||||||||||||||||| |
|
|
| T |
53753648 |
atattacatattatatgcagaggtcggagtttgaaccccggaaacctcacttctccacatttaaa |
53753712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 4e-26; HSPs: 165)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 34614001 - 34614093
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
34614001 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctagccactagg |
34614093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 75 - 173
Target Start/End: Complemental strand, 40535494 - 40535395
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
40535494 |
ggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
40535395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 33228981 - 33228879
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
33228981 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
33228882 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
33228881 |
acc |
33228879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 36182664 - 36182766
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
36182664 |
tagggatattgcatattatatgcaggagcaggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
36182763 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
36182764 |
acc |
36182766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 41509538 - 41509640
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
41509538 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
41509637 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
41509638 |
acc |
41509640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 4562800 - 4562708
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
4562800 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagg |
4562708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 8250349 - 8250258
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||| |||| |||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
8250349 |
tagggatattgcatattatatgcaggggccggggttcgaaccccagacacttcacctctccacaattaaattgtgtgagctctaaccactag |
8250258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 75 - 173
Target Start/End: Original strand, 20296443 - 20296542
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
20296443 |
ggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
20296542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 2643719 - 2643809
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
2643719 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccacta |
2643809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 1844839 - 1844940
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
1844839 |
tagggatattgcatattatatgcaggggccggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
1844938 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
1844939 |
ac |
1844940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 73 - 173
Target Start/End: Original strand, 5612977 - 5613078
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| | |||||||||||| || || |||| ||| ||||||||||||| | ||||| |
|
|
| T |
5612977 |
agggatattgcatattatatgcaagggccggggttcgaaccccggacaccccacttctccacaatttaattgtgtgagctctaaccactaggctacttga |
5613076 |
T |
 |
| Q |
172 |
cc |
173 |
Q |
| |
|
|| |
|
|
| T |
5613077 |
cc |
5613078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 75 - 163
Target Start/End: Complemental strand, 17777208 - 17777119
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||||||||| | ||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
17777208 |
ggatattgtatattatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgcgagccctatccactagg |
17777119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 18278465 - 18278373
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| || |||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
18278465 |
tagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactagg |
18278373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 30390417 - 30390325
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||| | ||||||||||| || || |||| ||| ||||||||||||| |
|
|
| T |
30390417 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacaccctacttctccacaatttaattgtgtgagctctaaccactagg |
30390325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 76 - 163
Target Start/End: Complemental strand, 40688683 - 40688595
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||| |||||||||||||| ||||||||||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
40688683 |
gatattgcattttatatgcaggggccagggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctaaccactagg |
40688595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 73 - 139
Target Start/End: Complemental strand, 3287103 - 3287036
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
3287103 |
agggatattgcatattatatgcaggggccggggttcgaaccccggatactccacttctccacatttaa |
3287036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 3438970 - 3439061
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
3438970 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
3439061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 76 - 173
Target Start/End: Complemental strand, 1309170 - 1309072
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
1309170 |
gatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
1309072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 6331584 - 6331685
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
6331584 |
tagggatattgcatattatatgcaggagcc-gggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
6331682 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
6331683 |
acc |
6331685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 70 - 163
Target Start/End: Original strand, 28194652 - 28194746
Alignment:
| Q |
70 |
gctagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
28194652 |
gctagggatattgcatattatatgcaggggctggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactagg |
28194746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 36005464 - 36005566
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
36005464 |
tagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccaataggctacttg |
36005563 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
36005564 |
acc |
36005566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 164
Target Start/End: Complemental strand, 11093836 - 11093743
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggt |
164 |
Q |
| |
|
||||||||| |||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||||||| ||||| |
|
|
| T |
11093836 |
tagggatatcgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccattaggt |
11093743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 19281630 - 19281731
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
19281630 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccattaggctacttg |
19281729 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
19281730 |
ac |
19281731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 173
Target Start/End: Original strand, 1071495 - 1071594
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| | | |||| |||||||| | ||||||| |
|
|
| T |
1071495 |
ggatattgtatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgtgctctagccactaggctacttgacc |
1071594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 73 - 163
Target Start/End: Original strand, 2305094 - 2305185
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||| || || |||| ||| |||| ||| |||| |
|
|
| T |
2305094 |
agggatattgcatattatatgcaggggccggggttcaaactctggacactccacttctccacaatttaattgtgtgagttctagccattagg |
2305185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 22653692 - 22653601
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||| ||| ||| |||| ||||||| |
|
|
| T |
22653692 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtatgagctctagccactag |
22653601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 4183198 - 4183300
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||| ||||| |||||||||||| ||||| |||| || |||| |||||||| | |||| |
|
|
| T |
4183198 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccgaacactccacttctccacaattaaattgtgtgaactctagccactaggctacttg |
4183297 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
4183298 |
acc |
4183300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 18862276 - 18862375
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||| ||||| |||||| ||||||| |||||| ||||||| |||||||||||||||||||||| ||| |||| |||||||| | |||| |
|
|
| T |
18862276 |
tagggatattgcata--atatgtaggggcaggggttcgaacccccgacactccacttctccacatttaaaatgtgtgagctctagccactaggctacttg |
18862373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 34355743 - 34355833
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||| |||||| |||||||||||| || || ||| ||| ||||||||||| |
|
|
| T |
34355743 |
tagggatattgtatattatatgcaggggccggggttcgaaccccagacactccacttctccacaatttaattgtatgagctctaaccacta |
34355833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 39408738 - 39408648
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
39408738 |
tagggatattgcatattatatgcaagagccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagctctagccacta |
39408648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 73 - 162
Target Start/End: Complemental strand, 43616298 - 43616208
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| | ||||||| |||| ||| ||||||||| |||| ||||||| |
|
|
| T |
43616298 |
agggatattgcatattatatgcaggggccgaagttcaaaccccggacatcccacttcttcacaattataatgtgcgaactctagccactag |
43616208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 11050805 - 11050704
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||| ||| ||||||| | |||||||||| | ||||| |||| ||| |||| |||||||||| |||| |
|
|
| T |
11050805 |
tagggatattacatattatatgcaggggctggggttcgaactccggacaccccacttctccataattaaattgtgtgagctctagccactaggttacttg |
11050706 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
11050705 |
ac |
11050704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 17034757 - 17034858
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| || |||||||||| |||||||||||| ||||| | || ||| |||| |||||||| | |||| |
|
|
| T |
17034757 |
tagggatattgcatattatatgcaggagtcggggttcgaatcccggacactccacttctccacaattaaattatgtgagctctagccactaggctacttg |
17034856 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
17034857 |
ac |
17034858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 17487726 - 17487795
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaa |
140 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| |||||||||||| ||||||||||||| ||||| |
|
|
| T |
17487726 |
tagggatattgcatattatatgcagtggctggggttcgaaccccggacacttcacttctccacaattaaa |
17487795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 40363119 - 40363019
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |||||| ||||||| ||||||||| |||| || |||| ||| |||||||||||| || |||| |
|
|
| T |
40363119 |
tagggatattgcatattatatgtaggggtcggggttcgaacccccgacactctacttctccatattt-aattgtgtgagctctaaccactagattacttg |
40363021 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
40363020 |
ac |
40363019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 132
Target Start/End: Complemental strand, 44857282 - 44857221
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctcca |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
44857282 |
tagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccacttctcca |
44857221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 5521268 - 5521176
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| ||||||| ||||| |||||| || || |||| ||| |||| |||||||| |
|
|
| T |
5521268 |
tagggatattgcatattatatgcaggggccgaggttcgaaccctggacactccacttttccacaatttaattgtgtgagttctagccactagg |
5521176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 15233435 - 15233503
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||| ||| |||| |
|
|
| T |
15233435 |
tagggatattgcatattatatgcaggggccggagttcaaaccccagacactccacttctctacagttaa |
15233503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 81 - 172
Target Start/End: Original strand, 18254620 - 18254712
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||| |||||||||||||||||||||| ||| || ||||| | |||||| ||||||||||||||| ||| || |||||||||||| |||||| |
|
|
| T |
18254620 |
tgcattttatatgcaggggccggggttcgaactccagacaccccacttcttcacatttaaaatgtgtgagctccaaccactaggttacttgac |
18254712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 25857343 - 25857251
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||| ||||||||| |||||||||||| |||| |||| ||| |||| |||||||| |
|
|
| T |
25857343 |
tagggatattgcatattatatgcaggagctggggttcgaacaccggacactccacttctccacaattaacttgtgtgagctctagccactagg |
25857251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 81 - 172
Target Start/End: Original strand, 32854563 - 32854655
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||| ||||||||| |||||||||||| |||||||||||| | |||||||||||||||||||||| ||| || | |||||||| | |||||| |
|
|
| T |
32854563 |
tgcattttatatgcaagggccggggttcgaaccccggacaccctacttctccacatttaaaatgtgtgagctccagccactaggctacttgac |
32854655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 138
Target Start/End: Original strand, 3446752 - 3446819
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacattta |
138 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
3446752 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
3446819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 4 - 63
Target Start/End: Complemental strand, 31096557 - 31096498
Alignment:
| Q |
4 |
tcagcctgcacaaactcaaaagaaggaccgcgtaagcattcgaccatagagattaacact |
63 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31096557 |
tcagcctgcataaactcatcagaaggaccgcataagcattcgaccatagagattaacact |
31096498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 44948618 - 44948709
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||| ||||||| |||||||| ||| || || |||| ||| |||| ||||||| |
|
|
| T |
44948618 |
tagggatattgcatattatatgcagggaccggggttcgaaccctggacactgcacttctctacaatttaattgtgtgagttctagccactag |
44948709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 18694807 - 18694909
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||| || ||| |||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
18694807 |
tagggatattgcatattatatgcaggaactggggttcgaatcccagacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
18694906 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
18694907 |
acc |
18694909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 19684095 - 19684196
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |||||| |||||| |||||||||||| ||||| |||| ||| |||| |||| ||| | |||| |
|
|
| T |
19684095 |
tagggatattgcatattatatgcaggagctggggttcgaacccc-gacactccacttctccacaattaaattgtgtgagctctagccacaaggctacttg |
19684193 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
19684194 |
acc |
19684196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 28692533 - 28692431
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| ||||| ||||||| |||||||||||| || || |||| ||| |||| ||| |||| | |||| |
|
|
| T |
28692533 |
tagggatattgcattttatatgcaggggtcggggttcgaacccaggacactccacttctccacaatttaattgtgtgagctctagccagtaggctacttg |
28692434 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
28692433 |
acc |
28692431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 44822445 - 44822547
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccac-atttaaaatgtgcgagatctaaccactaggttgctt |
169 |
Q |
| |
|
||||||||| |||| ||||||||||| |||||||||| |||||| |||||| ||||||||||| ||||||| |||| ||| |||| |||||||| | ||| |
|
|
| T |
44822445 |
tagggatatcgcattttatatgcaggagccggggttcgaaccccagacactccacttctccacaatttaaattgtgtgagctctagccactaggctactt |
44822544 |
T |
 |
| Q |
170 |
gac |
172 |
Q |
| |
|
||| |
|
|
| T |
44822545 |
gac |
44822547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 132
Target Start/End: Original strand, 1500983 - 1501044
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctcca |
132 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| |||||| |||||||||| |
|
|
| T |
1500983 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctcca |
1501044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 2289632 - 2289733
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||||| | |||||| ||||| ||||||| | |||||||||| || || |||| ||| ||||||||||||| | |||| |
|
|
| T |
2289632 |
taggaatattgcatattatatgcaggggtcagggttcgaaccctggacactccccttctccacaatttaattgtgtgagttctaaccactaggctacttg |
2289731 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
2289732 |
ac |
2289733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 13606291 - 13606202
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||||||||||| | |||||||||||| ||||| |||| ||| ||||||||||| |
|
|
| T |
13606291 |
tagggatattaagtattatatgcaggggtcgaggttcaaaccccggaaccccacttctccacaattaaattgtgtgagctctaaccacta |
13606202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 84 - 172
Target Start/End: Original strand, 13773434 - 13773523
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||| ||| | |||||||| |||||||||||||| ||||||||||| ||||| |||| ||| ||||||||||||| | |||||| |
|
|
| T |
13773434 |
atattatatgtaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
13773523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 75 - 163
Target Start/End: Complemental strand, 16385087 - 16384998
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| ||| ||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
16385087 |
ggatattgcattttatatgcagagaccggggttcgaactccggacactccacttctccacaattaaattgtgtgagctctagccactagg |
16384998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 17078479 - 17078580
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||| || ||||||||| ||||||||||||| ||||| | || ||| |||| |||||||| | |||| |
|
|
| T |
17078479 |
tagggatattgtatattatatgcaggagtcggggttcgaatcccggacacttcacttctccacaattaaattttgtgagctctagccactaggctacttg |
17078578 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
17078579 |
ac |
17078580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 17089265 - 17089366
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||| | |||||||| || |||||||||| |||||||||||| ||||| | || ||| |||| |||||||| | |||| |
|
|
| T |
17089265 |
taggaatattgcatattatatgcaggagtcggggttcgaatcccggacactccacttctccacaattaaattatgtgagctctagccactaggctacttg |
17089364 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
17089365 |
ac |
17089366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 23984262 - 23984197
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| ||||||||||||||| |||||| ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
23984262 |
tgcattttatatgcaggggccagggttcgaaccccggacaccccacttctccacatttaaaatgtg |
23984197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 27463750 - 27463661
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || ||||||||||| | || |||||||||||||| |||| ||| ||||||||||||| |
|
|
| T |
27463750 |
tagggatattgcatattatatgcaggagccgggg-tcgaaccccggacaccccatttctccacatttaatatgt--gagttctaaccactagg |
27463661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 33041911 - 33041810
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| ||||||| |||| | |||||| |||| ||||| |||| ||| |||||||||||| |||||| |
|
|
| T |
33041911 |
tagggatattgcatattatatgcaaaggccagggttcgaaccccgaacaccctacttcttcacaattaaattgtgtgagctctaaccactagactgcttg |
33041812 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
33041811 |
ac |
33041810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 38400332 - 38400438
Alignment:
| Q |
72 |
tagggatattgcatattatatgcagg----ggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttg |
166 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||| ||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |
|
|
| T |
38400332 |
tagggatattgcatattatatgcaggggccggccggggttcgaaccctggacaccccacttctccacaattaaattgtgtgagctctagccactaggcta |
38400431 |
T |
 |
| Q |
167 |
cttgacc |
173 |
Q |
| |
|
||||||| |
|
|
| T |
38400432 |
cttgacc |
38400438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 73 - 172
Target Start/End: Original strand, 4878232 - 4878331
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
|||||||||| |||||||||| ||||||| |||||| ||||||||||| | ||||||||||||||| | ||||| ||| |||| |||||||| | ||||| |
|
|
| T |
4878232 |
agggatattgtatattatatgtaggggccagggttcgaaccccggacaccccacttctccacattt-atatgtgtgagctctagccactaggctacttga |
4878330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 139
Target Start/End: Original strand, 1964376 - 1964443
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
1964376 |
agggacattgcataatttatgcaggggccggggttcaaaccccggacaccccacttctccatatttaa |
1964443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 3301833 - 3301916
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||| |||||| |||||| |||||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
3301833 |
tagggatattgcattttatatacaggggtcggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctcta |
3301916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 5947897 - 5947980
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||||| | |||| |||||||||||||||||| ||| || | |||||||| |
|
|
| T |
5947897 |
tgcattttatatgcaggggtcggggttcgaaccccggacaccccactcctccacatttaaaatgtgtgagctccagccactagg |
5947980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 14664006 - 14664073
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | |||||||||||| | ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
14664006 |
tagggacattgcataatttatgcaggggccagagttcaaaccccggacacccacttctccacaattaa |
14664073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 28153190 - 28153099
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
28153190 |
tagggatattgcatgttatatgcaggattcggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactag |
28153099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 29449470 - 29449553
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| |||||| ||||||| ||||||||||| ||||| |||| ||| |||| |
|
|
| T |
29449470 |
tagggatatcacattttatatgcaggggccggggttcgaaccccagacactctacttctccacaattaaattgtgtgagctcta |
29449553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 30392880 - 30392789
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||||||| |||||| |||||| ||||| | |||| ||||| |||| ||| |||||||||||| |
|
|
| T |
30392880 |
tagggatattgcatattatatgtaggagtcggggttcgaaccccagacactccacttgttcacaattaaattgtgtgagctctaaccactag |
30392789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 31223642 - 31223705
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||| |||||| |||||||||||| |
|
|
| T |
31223642 |
tagggatattgcatattatatgcaggggctggggtttgaaccccagacactccacttctccaca |
31223705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 37063542 - 37063593
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
37063542 |
tagggatattgcatattatatgcaggggccagggttcgaactccggacactc |
37063593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 38387685 - 38387736
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| ||||||| |
|
|
| T |
38387685 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactc |
38387736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 77 - 171
Target Start/End: Complemental strand, 40473593 - 40473498
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||| ||||||| | ||||||||||| ||||| |||| ||| |||| |||||||||| ||||| |
|
|
| T |
40473593 |
atattgcatgttatatgcaggggctggggtttgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggttacttga |
40473498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 11189950 - 11190052
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| || |||||| |||| | |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
11189950 |
tagggatattgcatgttatatgcaggggtcgggggtcgaaccccagacatcccacttctccacaattaaattgtgtgagctctagccattaggctacttg |
11190049 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
11190050 |
acc |
11190052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 17605449 - 17605523
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| |||||||| ||||| ||||| ||||||||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
17605449 |
tagggacattgcataatatatagaggggtcggggttcaaacctcggacatctcacttctcaacatttaaaatgtg |
17605523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 33262464 - 33262538
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||| |||| |||||||| |||||||||||| ||||| |||| |
|
|
| T |
33262464 |
tagggatatcgcattttatatgcaggggtcggggttcgaacctcggacactccacttctccacaattaaattgtg |
33262538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 34125768 - 34125858
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||| ||||||| | ||||||||| | | |||||||||||| ||||| ||||||||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
34125768 |
tagggacattgcatgatttatgcagggacggaggttcaaacccctgacacccacttctccacatttaaaatgtgtgagccctagccactag |
34125858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 35972607 - 35972505
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||| |||||| ||||||||||| ||||||| |||||||||||| |||||||||| || ||||| | || || |||||||| |||||| |||| |
|
|
| T |
35972607 |
taggaatattacatattttatgcaggggctggggttcgaaccccggacacttcacttctccgcaattaaattatgtgaactctaaccaataggttacttg |
35972508 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
35972507 |
acc |
35972505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 73 - 162
Target Start/End: Complemental strand, 44666390 - 44666301
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| ||||||||||| | |||||||||||| || || |||| ||| |||||||||||| |
|
|
| T |
44666390 |
agggatattgcataatatatgcagggatcggggttcgaaccccggacattccacttctccacaatt-aattgtgtgagctctaaccactag |
44666301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 6636015 - 6635966
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
6636015 |
tagggatattgcatattatatgcagggacgggggttcgaaccccggacac |
6635966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 16040263 - 16040364
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||| ||| ||||||| | |||||||||||| ||||| |||| ||| ||||||||||| ||| |||| |
|
|
| T |
16040263 |
tagggatattgcatgttatttgcaggggttggggtttgaactccggacatcccacttctccacaattaaattgtgtgagctctaaccactaagttacttg |
16040362 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
16040363 |
ac |
16040364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 27297197 - 27297298
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||| |||||||| || ||| ||| ||||||||||||| |||||||||| | ||||| |||| ||| |||| | |||| ||| |||| |
|
|
| T |
27297197 |
tagggatattgcatattgtatgcaggagctgggattcgaaccccggacactccacttctccataattaaactgtgtgagctctagcgactaagttacttg |
27297296 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
27297297 |
ac |
27297298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 29772326 - 29772225
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| |||||| |||||| || ||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
29772326 |
tagggatattgcatattatatgtcggggctggggttcgaaccccagacactccaattctccacaatttaattgtgtgagctctagccactaggctacttg |
29772227 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
29772226 |
ac |
29772225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 32609235 - 32609166
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||| ||| ||||||||| |||||||||||| ||||| |
|
|
| T |
32609235 |
tagggatattgcatattatatgcaagagtcggggttcgaactccggacactccacttctccacaattaaa |
32609166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 8322828 - 8322920
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| ||||||||||||||| |||||| |||||||| ||||| ||||| | |||||||||||| || || ||| ||| ||||||||||||| |
|
|
| T |
8322828 |
taggggtattgcatattatatacaggggtcggggttcgaaccctggacatcccacttctccacaatttaattgtatgagttctaaccactagg |
8322920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 13242775 - 13242711
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||| | |||||||||| |||||||| |||| |||||| ||||||||||||||||||| |
|
|
| T |
13242775 |
gatattgcataatttatgcaggggtcggggttcgaacctcggacacctcacttctccacatttaa |
13242711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 20919632 - 20919700
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||| ||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
20919632 |
tagggacattgcataatttatgctggggccggggttcgaaccccggacaccccacttctccacatttaa |
20919700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 28195182 - 28195114
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| ||||||||| | | |||||||||| |||||| |
|
|
| T |
28195182 |
tagggatattgcatattatatgcaagggcaggggttctaaccccggataccccacttctccatatttaa |
28195114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 79 - 142
Target Start/End: Original strand, 33587118 - 33587182
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaat |
142 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
33587118 |
attgcatattatatgtaggggtcgaggttcaaaccccggacaccccacttctccatatttaaaat |
33587182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 73 - 161
Target Start/End: Original strand, 5474929 - 5475019
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca--ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||| ||| ||||||| | |||||||||||| || || |||| ||| |||| |||||| |
|
|
| T |
5474929 |
agggatattgcatattatacgcaggagccggggttcgaactccggacacccccacttctccacaattcaattgtgtgagctctagccacta |
5475019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 7281736 - 7281654
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||| || |||||||||| |||||||| ||| ||||| |||| ||| |||| |
|
|
| T |
7281736 |
tagggatattgcatattatatgcaggggcc-gagttcgaatcccggacactccacttctctacaattaaattgtgtgagctcta |
7281654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 87 - 145
Target Start/End: Complemental strand, 7717638 - 7717579
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
7717638 |
ttatatgcaggggtcggggttcgaacttcggacactccacttctccacatttaaaatgtg |
7717579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 149
Target Start/End: Complemental strand, 10679421 - 10679346
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactca-cttctccacatttaaaatgtgcgag |
149 |
Q |
| |
|
||||||| |||||||||| | ||||| ||||||| |||| | ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
10679421 |
ggatattacatattatattcgggggctggggttcgaacctcagacgctcaacttctccacatttaaaatgtgcgag |
10679346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 14518315 - 14518398
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| || ||||||||||||||||||| |||| || ||||| |||||||||| |||||||||||| ||| || | |||||||| |
|
|
| T |
14518315 |
tgcattttgtatgcaggggccggggttcgaacctcgaacactccacttctccatatttaaaatgtgtgagctccagccactagg |
14518398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 30932494 - 30932403
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| | ||| ||| ||||| |||||||||||| ||||| ||| ||| |||| ||||||| |
|
|
| T |
30932494 |
tagggatattgcatattatatgcaggaggcggggtacgaacaccgcacactccacttctccacaattaaattgtatgagctctagccactag |
30932403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 38179293 - 38179242
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |||| ||||||||| |
|
|
| T |
38179293 |
tagggatattgcattttatatgcaggggctggggttcgaacctcggacactc |
38179242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 38557271 - 38557188
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||| |||||||||||| |||||| || ||| ||||| |||| ||| |||| |
|
|
| T |
38557271 |
tagggatatggcattttatatgcaggggtcggggttcgaaccccggacacttcacttatctacaattaaattgtgtgagctcta |
38557188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 40864421 - 40864472
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
40864421 |
taggaatattgcattttatatgcaggggccggggttcgaacaccggacactc |
40864472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 44898530 - 44898447
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| |||| ||| |||||||| | |||||||||||||||||||||| ||| |||| |
|
|
| T |
44898530 |
taggaatattgcatattatatgcaggaaccgacgttcgaactccggacaccccacttctccacatttaaaatgtgtgagctcta |
44898447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 466654 - 466552
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||| ||||||||||||| | | |||||||| || |||||||||| || ||||||||| ||||| |||| || |||| |||||||| | |||| |
|
|
| T |
466654 |
tagggatattacatattatatgcaagagtcggggttcgaaacccggacactccaattctccacaattaaattgtgtgaactctatccactaggctacttg |
466555 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
466554 |
acc |
466552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 69 - 123
Target Start/End: Complemental strand, 2950413 - 2950359
Alignment:
| Q |
69 |
agctagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| || | ||||||||| |
|
|
| T |
2950413 |
agctagggatattgcatattatatgcaggggttggggttcgaatctcggacactc |
2950359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 5112896 - 5112798
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| || || ||| | | |||||||||||| ||||| |||| ||| ||||||||||||| | |||||| |
|
|
| T |
5112896 |
ggatattgcatatgatatgcaggggccacggttcgaatcctggatatcccacttctccacaattaaattgtgtgagctctaaccactaggctacttgac |
5112798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 73 - 123
Target Start/End: Complemental strand, 15069846 - 15069796
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||| || ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
15069846 |
agggatattgtattttatatgcaggggtcggggttcgaaccccggacactc |
15069796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 17601101 - 17601191
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| |||| |||| ||||||| |||||||||||| || || | || ||| ||||||||||| |
|
|
| T |
17601101 |
tagggatattgcatatcatatgcaggggtcggagttcgaaccatggacactccacttctccacaatttaattatgtgagctctaaccacta |
17601191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 133
Target Start/End: Original strand, 18803233 - 18803295
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccac |
133 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
18803233 |
taggaatattgcatattatatgcaagagccggggttcgaaccctggacactctacttctccac |
18803295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 27082342 - 27082444
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| || || ||||||| |||||||||||| || || |||| ||| ||||| ||| ||| | |||| |
|
|
| T |
27082342 |
tagggatattatatattatatgcaggggccggagttcgaaacctggacactccacttctccacaatttaattgtgtgagctctaaacaccaggctacttg |
27082441 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
27082442 |
acc |
27082444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 36748909 - 36748982
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||| ||||||||||| ||||||||| |||||||| ||| || |||||| |||||||||||||||||||||| |
|
|
| T |
36748909 |
tagggacattgcatatta-atgcaggggtcggggttcgaacttcgaacactccacttctccacatttaaaatgtg |
36748982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 41566784 - 41566886
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||| ||||||||||||||||||||||| || |||| || ||| |||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
41566784 |
taggaatattgcatattatatgcaggggttggagttcgaatcccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
41566883 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
41566884 |
acc |
41566886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 79 - 139
Target Start/End: Original strand, 3596279 - 3596340
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | |||||||||| |||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
3596279 |
attgcataatttatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaa |
3596340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 15764952 - 15765021
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || ||| |||| |||||||||| ||| ||||| |
|
|
| T |
15764952 |
tagggatattgcatattatatgcaggggttggggttcgaatcccagacacctcacttctctacaattaaa |
15765021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 20497234 - 20497169
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| ||||||| |||||| ||||||| || ||||||||| | |||||||||||||||||||||| |
|
|
| T |
20497234 |
tgcattttatatgtaggggctggggttcgaatcccggacaccccacttctccacatttaaaatgtg |
20497169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 22718109 - 22718040
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||| || |||||||||||||| || ||||||| ||||||| ||||| |||||||||||| ||||| |
|
|
| T |
22718109 |
tagggatactgtatattatatgcaggagctggggttcgaaccccgaacactccacttctccacaattaaa |
22718040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 27913517 - 27913417
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| ||||| |||||| |||||||||||| || || |||| || ||||||||||||| | |||| |
|
|
| T |
27913517 |
tagggatattgcatattatatgca-gggttggggttcgaaccctagacactccacttctccacaatttaattgtgtaagctctaaccactaggctacttg |
27913419 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
27913418 |
ac |
27913417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 32190050 - 32190001
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
32190050 |
tagggacattgcataatttatgcaggggccggggttcgaaccccggacac |
32190001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 81 - 141
Target Start/End: Original strand, 32220998 - 32221059
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaa |
141 |
Q |
| |
|
||||| |||||||||||||||||||||| |||| |||||| | ||||| ||||||||||||| |
|
|
| T |
32220998 |
tgcattttatatgcaggggccggggttcgaacctcggacaccccacttttccacatttaaaa |
32221059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 76 - 156
Target Start/End: Complemental strand, 33549098 - 33549017
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaac |
156 |
Q |
| |
|
||||||| |||||||||||||| || ||||||| |||||| |||| ||||||||||||| ||||| |||| ||| |||||| |
|
|
| T |
33549098 |
gatattgtatattatatgcaggagctggggttcgaaccccaaacacttcacttctccacaattaaattgtgtgagctctaac |
33549017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 75 - 163
Target Start/End: Complemental strand, 38525598 - 38525509
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||| ||||||||||||| | |||||| ||||| | ||||| |||||||||||| ||||| |||| ||| |||| ||| |||| |
|
|
| T |
38525598 |
ggatattgcattttatatgcaggggtcagggttcgaacccggaacactccacttctccacaattaaattgtgtgagctctagccattagg |
38525509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 79 - 139
Target Start/End: Original strand, 44558031 - 44558092
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||| | ||||||||||| ||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
44558031 |
attgcataatttatgcaggggctggggttcgaaccccggacaccccacttctccacatttaa |
44558092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 580846 - 580810
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
580846 |
tattatatgcaggggccggggttcgaaccccggacac |
580810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 172
Target Start/End: Original strand, 13975149 - 13975249
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| |||| ||| ||||||| | || |||| |||| ||||| |||| ||| |||| ||||||| || ||||| |
|
|
| T |
13975149 |
agggatattgcatgttatatgcaggggtcggagttcgaactccggacaccccatttcttcacaattaaattgtgtgagctctagccactagattacttga |
13975248 |
T |
 |
| Q |
172 |
c |
172 |
Q |
| |
|
| |
|
|
| T |
13975249 |
c |
13975249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 17154681 - 17154717
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17154681 |
tattatatgcaggggccggggttcgaaccccggacac |
17154717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 91 - 134
Target Start/End: Complemental strand, 24506774 - 24506730
Alignment:
| Q |
91 |
atgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
24506774 |
atgcaggggccggtgttcaaaccccggacactccacttctccaca |
24506730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 75 - 134
Target Start/End: Original strand, 27016302 - 27016362
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||| |||||| ||| |||| ||||| ||||||| |||||||||||| |
|
|
| T |
27016302 |
ggatattgcatattatatacaggggtcggagttcgaaccctggacactccacttctccaca |
27016362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 29035008 - 29035044
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29035008 |
tattatatgcaggggccggggttcgaaccccggacac |
29035044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 29942174 - 29942106
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| || | ||||||| |||||||||| |||||| |
|
|
| T |
29942174 |
tagggatattgcatattatatgcagaggcgggggttcgaattctggacactccacttctccatatttaa |
29942106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 76 - 163
Target Start/End: Complemental strand, 30871365 - 30871277
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||| ||| ||||||||| | |||||| || |||||||||| |||||||||||| ||||| |||| || |||||||| |||| |
|
|
| T |
30871365 |
gatattgcattttacatgcaggggtcagggttcgaatcccggacactccacttctccacaattaaattgtgtgaactctaaccattagg |
30871277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 81 - 121
Target Start/End: Original strand, 36101690 - 36101730
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
36101690 |
tgcatattatatgcaggggctggggttcgaaccccggacac |
36101730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 76 - 143
Target Start/End: Complemental strand, 36112999 - 36112931
Alignment:
| Q |
76 |
gatattgca-tattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatg |
143 |
Q |
| |
|
||||||||| ||||||||||| | || | ||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
36112999 |
gatattgcaatattatatgcatgagctgaggttcgaaccctagacactcacttctccacatttaaaatg |
36112931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 159
Target Start/End: Original strand, 44186465 - 44186553
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
|||||||||| |||||||||||||| ||| | ||||| |||| |||||| | |||||||||||| ||||| |||| ||| |||| |||| |
|
|
| T |
44186465 |
tagggatattacatattatatgcagcggctgtggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccac |
44186553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 162
Target Start/End: Complemental strand, 9330545 - 9330458
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||||||||||| | ||| | ||| ||||||||| ||||| |||||| ||||| |||| ||| | || ||||||| |
|
|
| T |
9330545 |
gatattgcatattatatgcaggggctgaggtgcgaactccggacactccacttatccacaattaaattgtgtgagctatagccactag |
9330458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 81 - 145
Target Start/End: Complemental strand, 10463236 - 10463168
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca----ctcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| ||| | |||||||| |||||||||||||| |
|
|
| T |
10463236 |
tgcattttatatgcaggggccggggttcgaaccccgaacacccccccacttctctacatttaaaatgtg |
10463168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 99 - 173
Target Start/End: Original strand, 17498998 - 17499073
Alignment:
| Q |
99 |
gccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
17498998 |
gccggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
17499073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 19612737 - 19612788
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||| ||| || ||||||| |||||| ||||||| |
|
|
| T |
19612737 |
tagggatattgcatattatatgtaggagctggggttcgaaccccagacactc |
19612788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 73 - 139
Target Start/End: Complemental strand, 24581511 - 24581444
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| | |||| ||| |||||||||||||| |||| |
|
|
| T |
24581511 |
agggatattgcataatatatgcaggggctggggttcgtatcccgaacacctcacttctccacaattaa |
24581444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 26307640 - 26307731
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||| ||| || | ||||| ||||||||| ||| ||||||||||| ||||||| ||||||| |
|
|
| T |
26307640 |
taggaatattgcatattatatgcagggacggggattcgaatcatggacatctcacttcttcacgtttaaaatgtgtaagatctagccactag |
26307731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 33222202 - 33222119
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||| | || ||| ||||||||| |||||| | |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
33222202 |
tagggatattgcatattatatgtatggatcggcgttcaaacctcggacaccccacttctccacaattaaactgtgtgagctcta |
33222119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 99 - 165
Target Start/End: Complemental strand, 33233233 - 33233166
Alignment:
| Q |
99 |
gccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggtt |
165 |
Q |
| |
|
|||||||||| ||| |||||||||| ||||||||||| ||||| |||| ||| |||| |||||||||| |
|
|
| T |
33233233 |
gccggggttcgaactccggacactccacttctccacaattaaattgtgtgagttctagccactaggtt |
33233166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 33669758 - 33669809
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||| |||||| ||||||| |
|
|
| T |
33669758 |
tagggatattgcatattatatgtaggggccgatgttcgaaccccagacactc |
33669809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 79 - 145
Target Start/End: Original strand, 39635329 - 39635396
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||| |||||| |||| |||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
39635329 |
attgcataatatatgttggggtcggggttcgaactccagacactccacttctccacatttaaaatgtg |
39635396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 43895935 - 43896026
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||| ||| ||||||||| ||||||||||| ||||| ||||||| |||||||| ||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
43895935 |
tagggatatcacattttatatgcaagggccggggtttgaaccctggacactccacttctctacaattaaattgtgtgagctctagccactag |
43896026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 83 - 145
Target Start/End: Complemental strand, 45119744 - 45119681
Alignment:
| Q |
83 |
catattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||||||| ||| |||| |||| |||||||| || ||||||| |||||||||||| |
|
|
| T |
45119744 |
catattatatgcaggggtcggagttcgaacctcggacactccatttctccatatttaaaatgtg |
45119681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 121
Target Start/End: Complemental strand, 3037683 - 3037649
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
3037683 |
ttatatgcaggggccggggttcgaaccccggacac |
3037649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 75 - 145
Target Start/End: Original strand, 11832973 - 11833043
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||| ||||||||||| |||||| ||||||| |||| ||||||| || |||| |||| ||||| |||| |
|
|
| T |
11832973 |
ggatatttcatattatatgtaggggctggggttcgaaccacggacacccagttcttcacaattaaattgtg |
11833043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 85 - 154
Target Start/End: Original strand, 25067249 - 25067319
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||| ||| ||| |||||||||| | ||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
25067249 |
tattatatgtcgggtccgaggttcaaacctcagacacctcacttctccatatttaaaatgtgcgagctcta |
25067319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 76 - 145
Target Start/End: Original strand, 26336706 - 26336775
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||| || ||||| ||||||| |||| |||||||||| |
|
|
| T |
26336706 |
gatattgcatattatatgaaggggtcggggttcgaacctcgaacactccacttcttcaca-ttaaaatgtg |
26336775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 27449205 - 27449307
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||| |||| ||| ||| |||||| ||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
27449205 |
tagggatattgcattttatatgcatgggtcggggttcgaaccttggatactccacttcaccacaattaaattgtgtgagctctagccaataggctacttg |
27449304 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
27449305 |
acc |
27449307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 77 - 150
Target Start/End: Complemental strand, 34149723 - 34149649
Alignment:
| Q |
77 |
atattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgaga |
150 |
Q |
| |
|
|||| ||||||||||||||| | |||||||| |||||||||||| | ||||||||||| ||||| |||| |||| |
|
|
| T |
34149723 |
atatcgcatattatatgcagtgatcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgaga |
34149649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 102
Target Start/End: Complemental strand, 37352541 - 37352511
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37352541 |
tagggatattgcatattatatgcaggggccg |
37352511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 43936723 - 43936813
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||| |||| ||||||||||||| | |||||| || |||| |||| ||||||||||| ||||| |||| ||| ||||||||||| |
|
|
| T |
43936723 |
tagggatatcgcattttatatgcaggggtcagggttcgaagttcggatactccacttctccacaattaaattgtgtgagctctaaccacta |
43936813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 163
Target Start/End: Original strand, 15939318 - 15939403
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||| ||||||||| || |||||| ||||||| |||| | |||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
15939318 |
attgcataatatatgcagaggttagggttcgaaccccgaacaccccacttctccacatttaaaatgtgtgagctccagccactagg |
15939403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 23405218 - 23405267
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||||||| ||||| |||||| |
|
|
| T |
23405218 |
tagggacattgcataatatatgcaggggtcggggttcgaaccctggacac |
23405267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 155
Target Start/End: Original strand, 25093483 - 25093570
Alignment:
| Q |
72 |
tagggatattgcatat---tatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaa |
155 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||| || |||||||||| ||||| |||||| || || |||| ||| ||||| |
|
|
| T |
25093483 |
tagggatattgcatataattatatgcaggagccggggttcgaatcccggacactccacttttccacaatttaattgtgtgagctctaa |
25093570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 28646958 - 28646870
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||| ||| | | |||||||||||| | | ||||| ||| |||| ||||||| |
|
|
| T |
28646958 |
tagggatattgcatat---atgcaggggccggggttcgaaccccagaccccctacttctccacatattatatgtgtgagctctagccactag |
28646870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 33563257 - 33563189
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
||||||||||| || ||||||||||||| | |||||| |||||| |||||| |||||||||||| ||||| |
|
|
| T |
33563257 |
tagggatattgtattttatatgcaggggtc-gggttcgaaccccagacactccacttctccacaattaaa |
33563189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 121
Target Start/End: Complemental strand, 33816460 - 33816415
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||| ||||||| |||| |
|
|
| T |
33816460 |
gatattgcatattatatgcaggggtcgggtttcgaaccccgaacac |
33816415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 121
Target Start/End: Original strand, 35367437 - 35367482
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||| || |||||| ||||| |||||||||||| |
|
|
| T |
35367437 |
gatattgcatattatatacaagggccgaggttcgaaccccggacac |
35367482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 144
Target Start/End: Complemental strand, 42998884 - 42998827
Alignment:
| Q |
88 |
tatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgt |
144 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||| | |||||||| |||||||||||| |
|
|
| T |
42998884 |
tatatgcaggggccggagttcgaactccggacacccgacttctccgcatttaaaatgt |
42998827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 8234855 - 8234819
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
8234855 |
tattatatgtaggggccggggttcgaaccccggacac |
8234819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 9796929 - 9796965
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
9796929 |
tattatatgcaggggtcggggttcgaaccccggacac |
9796965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 87 - 123
Target Start/End: Complemental strand, 9937553 - 9937517
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
9937553 |
ttatatgcaggggctggggttcaaaccccgaacactc |
9937517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 20122538 - 20122502
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
20122538 |
tattatatgtaggggccggggttcgaaccccggacac |
20122502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 22297515 - 22297479
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
22297515 |
tattatatgcaggggcaggggttcgaaccccggacac |
22297479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 24202170 - 24202218
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| ||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
24202170 |
agggataatgcattatgtatgcaggggccggggttcgaaccccggacac |
24202218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 33116270 - 33116234
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
33116270 |
tattatattcaggggccggggttcgaaccccggacac |
33116234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 163
Target Start/End: Complemental strand, 35798070 - 35797982
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || || ||| ||| |||||||| ||| ||||| |||| ||| || | |||||||| |
|
|
| T |
35798070 |
gatattgcatattatatgcaggggttggggttcgaaacctggatactccacttctctacaattaaattgtgtgagctccagccactagg |
35797982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 140
Target Start/End: Complemental strand, 36089172 - 36089104
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||| |||||| || ||| |||||||||||| ||||| |
|
|
| T |
36089172 |
agggatattgcatattatatacaggggttggggtttgaaccccagatactccacttctccacaattaaa |
36089104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 36665462 - 36665498
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
36665462 |
tattatatgcaggggccggggttcgaacctcggacac |
36665498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 10874 - 10772
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
10874 |
tagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
10775 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
10774 |
acc |
10772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 59; Significance: 6e-25; HSPs: 132)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 19953876 - 19953774
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
19953876 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
19953777 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
19953776 |
acc |
19953774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 32611602 - 32611501
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
32611602 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
32611503 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
32611502 |
ac |
32611501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 10934621 - 10934713
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
10934621 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagttctagccactagg |
10934713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 17441887 - 17441795
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
17441887 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagg |
17441795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 743585 - 743676
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||||||| |||| ||||||| |
|
|
| T |
743585 |
tagggatattgcatattagatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagctctagccactag |
743676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 31802075 - 31802166
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
31802075 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
31802166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 7207866 - 7207968
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| || ||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
7207866 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctacttg |
7207965 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
7207966 |
acc |
7207968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 9246430 - 9246328
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||| ||||| |||||||||||| ||||| |||| |||||||| |||||||| | |||| |
|
|
| T |
9246430 |
tagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagatctagccactaggctacttg |
9246331 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
9246330 |
acc |
9246328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 28148781 - 28148679
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
28148781 |
tagggatattgcatattatatgcaggagccgggtttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
28148682 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
28148681 |
acc |
28148679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 32166391 - 32166493
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||| || || |||| ||| |||| |||||||| |||||| |
|
|
| T |
32166391 |
tagggatattgcatattatatgcaggggccgggatttgaaccccggacactccacttctccacaatttaattgtgtgagctctagccactaggctgcttg |
32166490 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
32166491 |
acc |
32166493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 33573839 - 33573940
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
33573839 |
tagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
33573938 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
33573939 |
ac |
33573940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 8297649 - 8297741
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
8297649 |
tagggatgttgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctaaccactagg |
8297741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 2251860 - 2251963
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacattt-aaaatgtgcgagatctaaccactaggttgctt |
169 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| | ||||||||||||||| |||||||| ||| ||| |||||||| | ||| |
|
|
| T |
2251860 |
tagggatattgcatactatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaaatgtgtgagctctggccactaggctactt |
2251959 |
T |
 |
| Q |
170 |
gacc |
173 |
Q |
| |
|
|||| |
|
|
| T |
2251960 |
gacc |
2251963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 3794221 - 3794119
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
3794221 |
tagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
3794122 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
3794121 |
acc |
3794119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 6210076 - 6210166
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| |||||| |||||||||||| || || |||| ||| ||||||||||| |
|
|
| T |
6210076 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtgtgagttctaaccacta |
6210166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 10517224 - 10517322
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||||| |
|
|
| T |
10517224 |
ggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttgac |
10517322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 13732834 - 13732935
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||| ||||| ||| ||| ||||||||||||| | |||| |
|
|
| T |
13732834 |
tagggatattgcatattatatgca-aggccggagttcaaaccccggacactctacttctccacaattaaattgtatgagctctaaccactaggctacttg |
13732932 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
13732933 |
acc |
13732935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 19892324 - 19892222
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||||||||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
19892324 |
tagggatattgcatattatatgtaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgagagctctagccactaggctacttg |
19892225 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
19892224 |
acc |
19892222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 28222885 - 28222986
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || |||||||||| |||||||||| | ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
28222885 |
tagggatattgcatattatatgcagaggccggggttcgaa-cccggacactccacttctccataattaaattgtgtgagctctaaccactaggctacttg |
28222983 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
28222984 |
acc |
28222986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 27218906 - 27219007
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| ||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
27218906 |
tagggatattgcatattatatgtaggagccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
27219005 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
27219006 |
ac |
27219007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 3294786 - 3294878
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||| | ||||||| |||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
3294786 |
tagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttcttcacaattaaattgtgtgagttctagccactagg |
3294878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 9435648 - 9435740
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||| || || |||| ||| |||| ||| |||| |
|
|
| T |
9435648 |
tagggatattgcatattatatgcaggggctggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagccattagg |
9435740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 7545351 - 7545442
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||| ||| | |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
7545351 |
tagggatattgcatattatatgcaggggccagggttcgaaccccgaacaccccacttctccacaattaaattgtgtgagctctagccactag |
7545442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 492927 - 493025
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||| | |||||||||||| ||||| |||| ||| | || | |||||||| |||||| |
|
|
| T |
492927 |
ggatattgcatattatatgcaggggccggggttcgaaccctggacaccccacttctccacaattaaattgtgtgagctgtagctactaggttacttgac |
493025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 3795822 - 3795720
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||| | |||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
3795822 |
tagggatattgcatattatatgcaggggctggggttcgaacctcagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
3795723 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
3795722 |
acc |
3795720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 7865403 - 7865313
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| || || |||| ||| |||| |||||| |
|
|
| T |
7865403 |
tagggatattgcatattatatgcaggggccggggtttgaaccctggacactccacttctccacaatttaattgtgtgagttctagccacta |
7865313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 15963991 - 15963889
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| ||||| ||||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
15963991 |
tagggatattgcatattttatgcaggggctggggttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagccactaggctacttg |
15963892 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
15963891 |
acc |
15963889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 31935121 - 31935223
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| ||||||||||||| |||||||||||| || || |||| || |||| ||| |||||| |||| |
|
|
| T |
31935121 |
tagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgtaagctctagccattaggttacttg |
31935220 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
31935221 |
acc |
31935223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 216228 - 216329
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||||||||| | ||||||| |||| |||||| | |||||||||||| ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
216228 |
tagggatattgcatgttatatgcagggtctggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctaaccactaggctacttg |
216327 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
216328 |
ac |
216329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 10483584 - 10483515
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
10483584 |
tagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccacaattaaa |
10483515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 29284288 - 29284389
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||| ||||||||||| | |||||||||||| ||||| |||| || |||| |||||||| | |||| |
|
|
| T |
29284288 |
tagggatattgcatattatatgaaggggccggagttcgaaccccggacaccccacttctccacaattaaattgtgtaagttctagccactaggctacttg |
29284387 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
29284388 |
ac |
29284389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 1435831 - 1435899
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
1435831 |
tagggatattacatattatatgcaggggccagggttcgaaccccggacattccacttctccacatttaa |
1435899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 9372249 - 9372157
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| ||||||| |||||||||||| || || |||| ||| |||| | |||||| |
|
|
| T |
9372249 |
tagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccacaatttaattgtgtgagttctagctactagg |
9372157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 159
Target Start/End: Original strand, 30704982 - 30705070
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||| |
|
|
| T |
30704982 |
tagggatattgcatgttatatgtaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccac |
30705070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 159
Target Start/End: Complemental strand, 32050013 - 32049925
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccac |
159 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||| ||| ||||| |||||||||||| ||||| |||| ||| |||| |||| |
|
|
| T |
32050013 |
tagggatattgcatattatatgcaggagccggggttcgaactccgaacactccacttctccacaattaaattgtgtgagctctagccac |
32049925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 79 - 173
Target Start/End: Complemental strand, 30347 - 30252
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||| ||||||| |||| || || |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
30347 |
attgcatattatatgcaggggccggggttcgaaccctggacactccacttcttcacaatttaattgtgtgagttctagccactaggctacttgacc |
30252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 978182 - 978094
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||| ||||||| | |||||||||||| ||||| ||| ||| ||||||||||| |
|
|
| T |
978182 |
tagggatattgcatattatatgcaggggtcggggttcgaacaccggacaccccacttctccacaattaaattgt--gagttctaaccacta |
978094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 3640536 - 3640627
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |||| |||||||| |||||||||||| || || |||| ||| |||| ||||||| |
|
|
| T |
3640536 |
tagggatattgcatagtatatgcaagggccggggttcgaacctcggacactccacttctccacaatttaattgtgtgagctctagccactag |
3640627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 15091470 - 15091533
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||| | |||||||||||| |
|
|
| T |
15091470 |
tagggatattgcatattatatgcaggggccggggttcgaatcccggacaccccacttctccaca |
15091533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 75 - 173
Target Start/End: Complemental strand, 16913945 - 16913847
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||| || ||||||||| || | ||||| || ||||||||||||| | ||||||| |
|
|
| T |
16913945 |
ggatattgcatattatatgcaggggtcggggttcgaaccccggacactccatttctccaca-ttcatatgtgttagctctaaccactaggctacttgacc |
16913847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 22574892 - 22574983
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||||| ||||||| ||||| |||||||||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
22574892 |
tagggatatcgcattttatatgcaggggttggggttcgaaccccgcacactccacttctccacaattaaattgtgtgagctctaaccactag |
22574983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 22997358 - 22997449
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||| |||||||||||| | ||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
22997358 |
tagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagctctagccactag |
22997449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 23791043 - 23790952
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||| |||||||||||| | ||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
23791043 |
tagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagctctagccactag |
23790952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 28030886 - 28030949
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| ||||||| |||||||||||| |
|
|
| T |
28030886 |
tagggatattgcatattatatgcaggggccagggttcgaaccctggacactccacttctccaca |
28030949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 32813695 - 32813624
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||| |||| ||||| |||| |
|
|
| T |
32813695 |
ggatattgcatattatatgcaggggccggggttcgaaccccggatactccacttcttcacaattaaattgtg |
32813624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 33646856 - 33646959
Alignment:
| Q |
72 |
tagggatattgcatatt-atatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgctt |
169 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||| |||| |||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | ||| |
|
|
| T |
33646856 |
tagggatattgcatatttatatgcaggggtcggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggctactt |
33646955 |
T |
 |
| Q |
170 |
gacc |
173 |
Q |
| |
|
|||| |
|
|
| T |
33646956 |
gacc |
33646959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 7328695 - 7328593
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||| |||||| |||||||||||| | |||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
7328695 |
tagggatattgcattttatatccaggggtcggggttcaaactctcgacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
7328596 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
7328595 |
acc |
7328593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 9888573 - 9888471
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| ||||| |||||||| | ||||||| ||||||||||||| |||||||||||| ||||| | || ||| ||||||||||||| | |||| |
|
|
| T |
9888573 |
tagggatattgtatattctatgcaggagtcggggtttgaaccccggacactccacttctccacaattaaattatgtgagctctaaccactaggctacttg |
9888474 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
9888473 |
acc |
9888471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 13158757 - 13158667
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||| | | ||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
13158757 |
tagggatattgcatattatatgcagagactggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccacta |
13158667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 13163613 - 13163523
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||| | | ||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| |||||| |
|
|
| T |
13163613 |
tagggatattgcatattatatgcagagactggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccacta |
13163523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 81 - 162
Target Start/End: Original strand, 18904296 - 18904378
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||||| | ||||||||||||||||||||||| ||| || | ||||||| |
|
|
| T |
18904296 |
tgcattttatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
18904378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 1969018 - 1969067
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1969018 |
tagggatattacatattatatgcaggggccggggttcgaaccccggacac |
1969067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 24319035 - 24319103
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||||| ||||||||||||| |||||||||||| |||| |
|
|
| T |
24319035 |
tagggacattgcataatttatgcaggggccggggttcgaaccccggacactccacttctccacaattaa |
24319103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 31803644 - 31803552
Alignment:
| Q |
72 |
tagggatattgcatatt-atatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||| ||||| |||||| ||||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
31803644 |
tagggatattgcatatttatatgtaggggccgggattcgaaccctggacacctcacttctccacaattaaattgtgtgagctctagccactag |
31803552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 894680 - 894629
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
894680 |
tagggatattgcatattatatgcaggggtcgaggttcgaaccccggacactc |
894629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 158
Target Start/End: Original strand, 8439697 - 8439784
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaacca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||| || || |||||||| ||||||||||| || || |||| ||| |||||||| |
|
|
| T |
8439697 |
tagggatattgcatattatatgcaggggtcgggattcgaatcctggacactcaacttctccacaatttaattgtgtgagctctaacca |
8439784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 12284143 - 12284234
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||| ||| ||||| ||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
12284143 |
tagggatattgaatattatatgcaggtgtcggggttcgaactccggaaactccacttctccacaattaaattgtgtgagctctagccactag |
12284234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 83 - 173
Target Start/End: Complemental strand, 13116661 - 13116570
Alignment:
| Q |
83 |
catattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| | | |||||||||| ||||| |||| ||| |||| |||||||| | ||||||| |
|
|
| T |
13116661 |
catattatatgcaagggccggggttcgaaccccggacacccctcttctccacaattaaattgtgtgagctctagccactaggctacttgacc |
13116570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 16268179 - 16268108
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||| ||| |||||||||| | ||||| |||| |
|
|
| T |
16268179 |
ggatattgcattttatatgcaggggccggggttcgaaccccggatactccacttctccagaattaaattgtg |
16268108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 138
Target Start/End: Complemental strand, 16966442 - 16966375
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacattta |
138 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
16966442 |
tagggatattgcatattatatgcaagtgtcggggttcaaactccggacactccacttctccatattta |
16966375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 81 - 139
Target Start/End: Original strand, 27667191 - 27667250
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
27667191 |
tgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaa |
27667250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 31104904 - 31104986
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| || |||||||| | |||||||||||| |||||||||| ||| |||| |
|
|
| T |
31104904 |
tagggatattacatattatatgcaggggccggagttcgaatcccggacaccccacttctccaca-ttaaaatgtgtgagctcta |
31104986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 81 - 163
Target Start/End: Complemental strand, 32621621 - 32621538
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||||||||||| || ||| ||||| | |||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
32621621 |
tgcattttatatgcaggggccggggttcgaatcccagacaccccacttctccacatttaaaatgtgtgagctccagccactagg |
32621538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 361185 - 361275
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| ||| || |||| | |||||||||| ||||||||| || ||| |||| |||||| |
|
|
| T |
361185 |
tagggatattgcatattatatgcaggagccgaggttcgaactccagacaccccacttctccatatttaaaatatgtgagctctagccacta |
361275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 2816912 - 2817014
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||| | | ||| ||| ||||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
2816912 |
tagggatattgcatgttatatgcaggggctgagattcgaactccggacaccccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
2817011 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
2817012 |
acc |
2817014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 7177317 - 7177419
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||| || |||||||||||||| ||||||| |||||| |||| | |||||||||||| ||||| ||| ||| |||| |||||||| | |||| |
|
|
| T |
7177317 |
tagggatattgtattttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaacagtgtgagctctagccactaggctacttg |
7177416 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
7177417 |
acc |
7177419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 7418300 - 7418402
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||| ||||| ||||||| |||||||||| | || || |||| ||| |||| ||||| || | |||| |
|
|
| T |
7418300 |
tagggatattgcatattatatgcaggggcctgagttcgaaccctggacactccacttctccataatttaattgtgtgagctctagccactcggctacttg |
7418399 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
7418400 |
acc |
7418402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 8857112 - 8857207
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||| | |||||||||||| ||||| |||| ||| |||| |||||||| | ||||| |
|
|
| T |
8857112 |
tagggatattacatattatatgcaggggccggggttcgaaccc------cccacttctccacaattaaattgtgtgagctctagccactaggctacttga |
8857205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 10913123 - 10913037
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||| |||||| |||||||||| | || || |||| ||| |||| |||||| |
|
|
| T |
10913123 |
gatattgcatattatatgcaggggtcggggttcgaaccccagacactccacttctccataatttaattgtgtgagctctagccacta |
10913037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 14709064 - 14708978
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||| ||||||||| || || || |||| ||| |||| |||||| |
|
|
| T |
14709064 |
gatattgcatattatatgtaggggccggggttcgaactccggacactccacttctcctcaatttaattgtgtgagttctagccacta |
14708978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 133
Target Start/End: Complemental strand, 17454789 - 17454731
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccac |
133 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
17454789 |
gatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
17454731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 24758761 - 24758835
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||| ||||||||| || ||||||||||||| ||||| |||| |
|
|
| T |
24758761 |
tagggatatcgcattttatatgcaggggtcggggttcgaaccccggatacttcacttctccacaattaaattgtg |
24758835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 30885618 - 30885516
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| |||||| |||||| || ||||||||| || || |||| || |||| |||||||| | |||| |
|
|
| T |
30885618 |
tagggatattgcatattatatacaggggctggggttcgaaccccagacactccatttctccacaatttaattgtgtgaactctagccactaggctacttg |
30885519 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
30885518 |
acc |
30885516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 5052121 - 5052020
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
||||||||| |||| ||||||||||| | ||||||| |||||||||||||| |||||||| ||||| |||| ||| |||| |||||||| | ||||| |
|
|
| T |
5052121 |
tagggatatcgcattttatatgcaggagtcggggtttgaaccccggacactccactctccacaattaaattgtgtgagctctagccactaggctacttga |
5052022 |
T |
 |
| Q |
172 |
cc |
173 |
Q |
| |
|
|| |
|
|
| T |
5052021 |
cc |
5052020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 5944448 - 5944497
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| || ||||| |
|
|
| T |
5944448 |
tagggatattgcatattatatgcaggggtcggggttcaaactccagacac |
5944497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 6658619 - 6658570
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
6658619 |
tagggaaattgcataatatatgcaggggccggggttcgaaccccggacac |
6658570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 132
Target Start/End: Original strand, 7072100 - 7072161
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctcca |
132 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||||| |||||||||||||| ||||||||| |
|
|
| T |
7072100 |
tagggatattacatattatatgcaggagtcggggttcgaaccccggacactctacttctcca |
7072161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 7581066 - 7581167
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| ||| || |||| || ||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
7581066 |
tagggatattgcattttatatgcaggggttggggttcgaacgccagacaccttacttctccacaattaaattgtgtgagctctagccactaggctacttg |
7581165 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
7581166 |
ac |
7581167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 9704439 - 9704539
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| |||||| || ||| | |||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
9704439 |
tagggatattgcatattatatgcaggagccgaggttcgaacccc-gatactccgcttctccacaattaaattgtgtgagctctagccactaggctacttg |
9704537 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
9704538 |
ac |
9704539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 67 - 139
Target Start/End: Original strand, 17534864 - 17534937
Alignment:
| Q |
67 |
acagctagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||| |||||| |||||||| | ||||||||||||||||||| ||| ||||||| || |||||||||||||||| |
|
|
| T |
17534864 |
acaggtagggacattgcataatttatgcaggggccggggttcgaactccggacacctgacttctccacatttaa |
17534937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 19618776 - 19618672
Alignment:
| Q |
72 |
tagggatattgcatattatatg--caggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgct |
168 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| ||||||||||| | |||||||||||| ||||| ||| ||| || |||||||||| | || |
|
|
| T |
19618776 |
tagggatattgcatattatatatacaggggctggggttcgaaccccggacaccccacttctccacaattaaattgtatgagctcgaaccactaggctact |
19618677 |
T |
 |
| Q |
169 |
tgacc |
173 |
Q |
| |
|
||||| |
|
|
| T |
19618676 |
tgacc |
19618672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 6419126 - 6419063
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggac-actcacttctccacatttaa |
139 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||||||| || ||||||||||||||||| |
|
|
| T |
6419126 |
gatattgcatattatatgcagggtccggggttcgaa-cccggacaacccacttctccacatttaa |
6419063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 7977078 - 7977170
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||| ||||||||| ||||||||| ||||||| |||||| ||||| | |||||| | |||||||||||| ||| ||||||||||||| |
|
|
| T |
7977078 |
tagggatactgcatattacatgcaggggtcggggtttaaaccctggacattttacttcttcgtatttaaaatgtgtgagctctaaccactagg |
7977170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 19374888 - 19374820
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaa |
139 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||| ||||| |||||||||| |||||| |
|
|
| T |
19374888 |
taggaatattgcatattatatgcaggggttggggttcgaaccccgaacactccacttctccaaatttaa |
19374820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 34432845 - 34432753
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||| |||||| |||||| |||||||||||| || || | || || ||||||||||||| |
|
|
| T |
34432845 |
tagggatattgcatattatatgcagaggttggggttcgaaccccagacactccacttctccacaatttaattatgtgaactctaaccactagg |
34432753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 3709890 - 3709973
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||| ||||| | |||||||||||||||||||||| ||| || | |||||||| |
|
|
| T |
3709890 |
tgcatattatatgcaaggggtggggttcgaaccccagacaccccacttctccacatttaaaatgtgagagctccagccactagg |
3709973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 4408380 - 4408431
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||| | ||||||| |
|
|
| T |
4408380 |
tagggatattgcatattatatgcaggggctggggttcgaaccacagacactc |
4408431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 7153810 - 7153861
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
7153810 |
tagggatattgcatgttatatgcaggggccgaggttcgaatcccggacactc |
7153861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 173
Target Start/End: Complemental strand, 15449608 - 15449509
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgacc |
173 |
Q |
| |
|
|||||||||||||| |||||||| | |||||||| |||| ||||||| |||||||||||| | ||| |||| ||| |||||| |||||| | ||||||| |
|
|
| T |
15449608 |
ggatattgcatattgtatgcaggagacggggttcgaaccttggacactccacttctccacaatgaaattgtgtgagctctaactactaggctacttgacc |
15449509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 30916343 - 30916426
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||| ||||| ||||||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
30916343 |
tagggatattgcatgttatatgcgggggttggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctcta |
30916426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 32412361 - 32412286
Alignment:
| Q |
72 |
tagggatattgcatattatatgca-ggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtg |
145 |
Q |
| |
|
|||||||||||||||||||||||| ||||| || |||| || |||||||||| |||||||||||| ||||| |||| |
|
|
| T |
32412361 |
tagggatattgcatattatatgcagggggctggagttcgaatcccggacactccacttctccacaattaaattgtg |
32412286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 87 - 172
Target Start/End: Original strand, 389370 - 389456
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||| ||| |||| ||||||||||||| ||||| |||||| ||||| ||| ||| |||||||||||| || |||||| |
|
|
| T |
389370 |
ttatatgcaggggtcggagttcgaaccccggacactccacttatccacaattaaattgtatgagctctaaccactagattacttgac |
389456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 73 - 123
Target Start/End: Complemental strand, 3012770 - 3012720
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
3012770 |
agggatattgcattttatatgcaggggctagggttcaaatcccggacactc |
3012720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 28237300 - 28237230
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccgggg-ttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || ||||| ||||||| |||||||||||| ||||| |
|
|
| T |
28237300 |
tagggatattgcatattatatgcaggagccggggatttgaaccctggacactccacttctccacaattaaa |
28237230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 33697161 - 33697059
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| |||| || |||||||||| ||||| |||||| ||||| | | ||| |||| |||||||| | |||| |
|
|
| T |
33697161 |
tagggatattgcattttatatgcaggggtcggagttcgaatcccggacactccacttttccacaattaaattatatgagctctagccactagggtacttg |
33697062 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
33697061 |
acc |
33697059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 2500562 - 2500470
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||| || || ||| |||| || ||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
2500562 |
tagggatattgcatattatatgtagaggtcggagttcgaattccggacactccacttctccacaattaaattgtgtgagctctagacactagg |
2500470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 75 - 140
Target Start/End: Complemental strand, 2688624 - 2688557
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact--cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||| ||| ||| || |||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
2688624 |
ggatattgcatattatatacagaggctggagttcgaaccccggacacttccacttctccacaattaaa |
2688557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 4869746 - 4869710
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4869746 |
tagggatactgcatattatatgcaggggccggggttc |
4869710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 75 - 111
Target Start/End: Complemental strand, 6313860 - 6313824
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6313860 |
ggatattgcatattatatgcaggggctggggttcaaa |
6313824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 6530267 - 6530231
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6530267 |
tattatatgcaggggccggggttcaaacctcggacac |
6530231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 22983612 - 22983648
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22983612 |
tattatatgcaggggccggggttcgaaccccggacac |
22983648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 23804796 - 23804760
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23804796 |
tattatatgcaggggccggggttcgaaccccggacac |
23804760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 32670102 - 32670010
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||| |||||||||| | ||||||||||| ||||||| |||||| ||||| | ||||||||| ||||| |||||| ||| || || ||||||| |
|
|
| T |
32670102 |
taggaatattgcataatttatgcaggggcaggggttcgaacccctgacaccctacttctccatatttataatgtgtgagctccaaacactagg |
32670010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 2426086 - 2426149
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||| ||||| ||||||||||||| ||| ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
2426086 |
taggaatattacatattatatgcaagggttggggttcgaaccccggacactccacttctccaca |
2426149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 111
Target Start/End: Complemental strand, 10501187 - 10501148
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
10501187 |
tagggatattgcatattatatgcaggggtcgaggttcaaa |
10501148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 138
Target Start/End: Original strand, 10628636 - 10628703
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacattta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||| ||| ||||||| | |||| |||||||||| |
|
|
| T |
10628636 |
tagggatattgcatattatatgcaggggctggtgttcgaacatcggacaccctacttttccacattta |
10628703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 80 - 154
Target Start/End: Original strand, 10913439 - 10913514
Alignment:
| Q |
80 |
ttgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
||||||||||||| |||||| |||||||| ||||||||| |||| ||||||| ||| ||||| |||| ||| |||| |
|
|
| T |
10913439 |
ttgcatattatatacaggggtcggggttcgaaccccggatactctacttctctacaattaaattgtgtgagctcta |
10913514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 72 - 142
Target Start/End: Original strand, 13436566 - 13436637
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaat |
142 |
Q |
| |
|
|||||| |||||||| ||||||||||||| |||||||||||| |||| | |||||||||| ||||||||| |
|
|
| T |
13436566 |
tagggacattgcataatatatgcaggggcaatggttcaaacccctgacaccccacttctccatatttaaaat |
13436637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 81 - 163
Target Start/End: Original strand, 32616415 - 32616498
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||| |||||||||||||| ||||||| || |||||||| | |||||||| ||||||||||||| ||| || | |||||||| |
|
|
| T |
32616415 |
tgcattttatatgcaggggctggggttcgaatcccggacaccccacttctctgcatttaaaatgtgtgagctccagccactagg |
32616498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 88 - 145
Target Start/End: Complemental strand, 1368219 - 1368161
Alignment:
| Q |
88 |
tatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtg |
145 |
Q |
| |
|
||||||||||||| |||||||||| || ||||| | |||||||||||||||||||||| |
|
|
| T |
1368219 |
tatatgcaggggctagggttcaaactccagacaccccacttctccacatttaaaatgtg |
1368161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 122
Target Start/End: Original strand, 7414351 - 7414401
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| ||| | ||||||| |
|
|
| T |
7414351 |
tagggatattgcatattatatgcaagggccagggttcgaactctggacact |
7414401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 87 - 121
Target Start/End: Original strand, 10455776 - 10455810
Alignment:
| Q |
87 |
ttatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
10455776 |
ttatatgcaggggccggggttcgaaccccggacac |
10455810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 81 - 162
Target Start/End: Complemental strand, 32142075 - 32141993
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||| ||||||| |||||| ||||||| |||||| ||||| | |||| ||||||||||||||||| ||| || | ||||||| |
|
|
| T |
32142075 |
tgcattttatatgtaggggctggggttcgaaccccagacaccccacttttccacatttaaaatgtgtgagctccagccactag |
32141993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 160
Target Start/End: Complemental strand, 3299015 - 3298927
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccact |
160 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| ||| |||| || ||| | |||||||||| |||| ||||||| ||| |||||||||| |
|
|
| T |
3299015 |
tagggatattgcatataatatgcaggggtcggaattcgaacctcgaacatcccacttctccatattt-aaatgtgtgagctctaaccact |
3298927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 132
Target Start/End: Original strand, 4661118 - 4661179
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctcca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||| |||||| |||| | |||||||||| |
|
|
| T |
4661118 |
tagggatattgcatattatatgcaggggttgggtttcgaaccccagacattccacttctcca |
4661179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 75 - 162
Target Start/End: Original strand, 29733653 - 29733742
Alignment:
| Q |
75 |
ggatattgcatattatatgcagggg-ccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| || | |||||| ||||||||||| || ||||| |||| ||| | || ||||||| |
|
|
| T |
29733653 |
ggatattacatattatatgcaggggcccggggttcgaaacgcggacacctcacttctccgcaattaaattgtgtgagctttagccactag |
29733742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 30938410 - 30938459
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
30938410 |
tagggacattgcataatatatgcagggaccggggttcgaaccccagacac |
30938459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 2970221 - 2970257
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
2970221 |
tattatatgtaggggccgaggttcaaaccccggacac |
2970257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 6228335 - 6228287
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
6228335 |
agggataatgcacaatatgtgcaggggccggggttcgaaccccggacac |
6228287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 81 - 121
Target Start/End: Complemental strand, 7897157 - 7897117
Alignment:
| Q |
81 |
tgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
7897157 |
tgcataatatatgcaggggtcggggttcgaaccccggacac |
7897117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 9064898 - 9064934
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
9064898 |
tattatatgcaggggccggggttcgaaccccagacac |
9064934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 9491798 - 9491762
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
9491798 |
tattatatgtaggggccggggttcgaaccccggacac |
9491762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 10373627 - 10373663
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
10373627 |
tattatatgcaggggtcggggttcgaaccccggacac |
10373663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 12089129 - 12089165
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
12089129 |
tattatatgcaggggccggagttcgaaccccggacac |
12089165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 12101918 - 12101954
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
12101918 |
tattatatgcaggggccggcgttcgaaccccggacac |
12101954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 84 - 139
Target Start/End: Complemental strand, 12882067 - 12882011
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
||||||||| || |||||||||||| ||||||||||| | ||||| ||||||||||| |
|
|
| T |
12882067 |
atattatattcatgggccggggttcgaaccccggacaccccacttttccacatttaa |
12882011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 14981765 - 14981729
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
14981765 |
tattatatgcaggggccggggttcgaaccctggacac |
14981729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 100
Target Start/End: Complemental strand, 16719367 - 16719339
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16719367 |
tagggatattgcatattatatgcaggggc |
16719339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 25020591 - 25020555
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
25020591 |
tattatatgcaggggcctgggttcgaaccccggacac |
25020555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 26528599 - 26528635
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
26528599 |
tattatatgcaggggtcggggttcaaacctcggacac |
26528635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 31789615 - 31789579
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
31789615 |
tagggatattgcatattatatgcaggagccggagttc |
31789579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 90 - 161
Target Start/End: Complemental strand, 35038732 - 35038661
Alignment:
| Q |
90 |
tatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | || ||||| |||||| || |||||||| || |||||||| |
|
|
| T |
35038732 |
tatgcaggggccggggttcgaaccccggacaccccatttctctacattt-aattgtgcgagctccaaccacta |
35038661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 59805 - 59896
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||||||| |
|
|
| T |
59805 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactag |
59896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 74 - 171
Target Start/End: Original strand, 83649 - 83747
Alignment:
| Q |
74 |
gggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttga |
171 |
Q |
| |
|
|||||||||||||||||||||||| || | ||||| ||||||||| ||| ||||| |||| | ||||| ||| || | |||| ||||||||| ||||| |
|
|
| T |
83649 |
gggatattgcatattatatgcaggagctgaggttcgaaccccggatactccacttttccataattaaattgtacgcgctctagtcactaggttacttga |
83747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 11168 - 11066
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
11168 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccattaggctacttg |
11069 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
11068 |
acc |
11066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 21496 - 21394
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
21496 |
tagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccattaggctacttg |
21397 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
21396 |
acc |
21394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 17642 - 17744
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
17642 |
tagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
17741 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
17742 |
acc |
17744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 27978 - 27876
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| | ||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
27978 |
tagggatattgcattttatatgcaggggccggggttcgatccccggacactccacttctccacaattaaattgtgtgagttctagccactaggctacttg |
27879 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
27878 |
acc |
27876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 422 - 512
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||| ||| ||||| |||| || ||||||||||| |
|
|
| T |
422 |
tagggatattgcatattatatgcaggggccggggttcgaacctcggacactccacttctctacaattaaattgtgtgaactctaaccacta |
512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 18527 - 18425
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||| | |||||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
18527 |
tagggatattgcatattatatacaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccattaggctacttg |
18428 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
18427 |
acc |
18425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 23383 - 23484
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || |||||||||| |||||||||| | ||||| |||| ||| ||||||||||||| | |||| |
|
|
| T |
23383 |
tagggatattgcatattatatgcagaggccggggttcgaa-cccggacactccacttctccataattaaattgtgtgagctctaaccactaggctacttg |
23481 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
23482 |
acc |
23484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 37462 - 37392
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccgggg-ttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || ||||| ||||||| |||||||||||| ||||| |
|
|
| T |
37462 |
tagggatattgcatattatatgcaggagccggggatttgaaccctggacactccacttctccacaattaaa |
37392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 3688 - 3789
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||| ||||||||||||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
3688 |
tagggatattgcatattatatgcaggaaccagggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
3787 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
3788 |
ac |
3789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 8988 - 9080
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
8988 |
tagggatattgcatattatatgcaggagccggagttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagccactagg |
9080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 17309 - 17217
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| ||||||||||||| ||||||| |||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
17309 |
tagggatattgcattttacatgcaggggccggggttcgaaccccggacactccacttcttcacaattaaattgtgtgagctctagccactagg |
17217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 73 - 163
Target Start/End: Original strand, 24403 - 24493
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| ||||||||||||| ||||||| ||||||| ||||||| ||| |||| |||||||| |
|
|
| T |
24403 |
agggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttcacattt-aaatgtgtgagctctagccactagg |
24493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 72 - 162
Target Start/End: Original strand, 12016 - 12107
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||| ||||| |||| || |||| ||||||| |
|
|
| T |
12016 |
tagggatattgcatattatatgcaggagccggggtttgaaccccggacactccacttctccacaattaaattgtgtgaactctagccactag |
12107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 46548 - 46599
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||| ||||||| |
|
|
| T |
46548 |
tagggatattgcatattatatgcaggggctggggttcgaaccccagacactc |
46599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 4062 - 3960
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| |||||| |||||| |||||||||||| || || |||| ||| |||| |||||||| | |||| |
|
|
| T |
4062 |
tagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagccactaggctacttg |
3963 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
3962 |
acc |
3960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 73 - 162
Target Start/End: Original strand, 56346 - 56436
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||| ||| ||||||||| ||||| |||| ||| | || ||||||| |
|
|
| T |
56346 |
agggatattgcatattatatgcaggggccggggttcgaaccccagacacttcatttctccacaattaaattgtgtgagttttagccactag |
56436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 12481 - 12573
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||| ||| | |||||||||||| ||||| |||| ||| |||| |||||||| |
|
|
| T |
12481 |
tagggatattgcatattatatgcaggaggcggggttcgaaccccgcacattccacttctccacaattaaattgtgtgagctctagccactagg |
12573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 131
Target Start/End: Complemental strand, 13251 - 13192
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactcacttctcc |
131 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
13251 |
tagggatattgcatattatatgcaggggttggggttcgaaccccggacacccacttctcc |
13192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 1886 - 1937
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
1886 |
tagggatattgcatattatatgcaggggccgaggttcgaaccccggacactc |
1937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 72 - 134
Target Start/End: Complemental strand, 68 - 5
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
68 |
tagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccaca |
5 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 75 - 161
Target Start/End: Original strand, 315674 - 315761
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
||||||||||| ||||||||||||| || |||| ||||||||||| | ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
315674 |
ggatattgcattttatatgcaggggtcgatgttcgaaccccggacatcccacttctccacatttaaaatgtgtgaactctaaccacta |
315761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0276 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 1282 - 1374
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
|||| ||||||||| ||||||| ||||||||||||||||||| |||||||| |||||||||||| || || | || ||| |||| |||||||| |
|
|
| T |
1282 |
taggaatattgcattttatatgtaggggccggggttcaaacctcggacactccacttctccacaatttaattatgtgagctctagccactagg |
1374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 79 - 134
Target Start/End: Complemental strand, 66629 - 66573
Alignment:
| Q |
79 |
attgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
66629 |
attgcatattatatgcaggggccggggttcgaaccccggacacctcacttccccaca |
66573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 134
Target Start/End: Original strand, 197 - 256
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
197 |
gatattgcatattatatgcaggggccggggttcgaaccccaaacacttcacttctccaca |
256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 134
Target Start/End: Complemental strand, 124 - 65
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccaca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||| |
|
|
| T |
124 |
gatattgcatattatatgcaggggccggggttcgaaccccaaacacttcacttctccaca |
65 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 72 - 154
Target Start/End: Original strand, 15786 - 15869
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatcta |
154 |
Q |
| |
|
|||||||||||||||||||||||||| | || ||||| ||||||||| ||| |||||||||||| ||||| |||| ||| |||| |
|
|
| T |
15786 |
tagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccacaattaaattgtgtgagctcta |
15869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1236 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold1236
Description:
Target: scaffold1236; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 164 - 67
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttgac |
172 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||| ||||| | ||||| | ||||| ||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
164 |
ggatattgcatatta-atgcagggacgggggttcgaaccctgaacacttcgcttcttcacatttaaaatgtgtgacctctaaccactaggttacttgac |
67 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 112130 - 112232
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||| || | |||| ||| |||||||||||| ||||| |||| ||| |||| |||||||| | |||| |
|
|
| T |
112130 |
tagggatattgcatattatatgcaggagccgaggtttgaatctcggatactccacttctccacaattaaattgtgtgagctctagccactaggctacttg |
112229 |
T |
 |
| Q |
171 |
acc |
173 |
Q |
| |
|
||| |
|
|
| T |
112230 |
acc |
112232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 72 - 169
Target Start/End: Complemental strand, 8873 - 8775
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgctt |
169 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | ||||||||||||| || ||||||||| || || |||| || |||| |||||||| ||||| |
|
|
| T |
8873 |
tagggatattgcatattttatgcaggggccgggggttgaaccccggacactccatttctccacaatttaattgtgtcagctctagccactaggctgctt |
8775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 65835 - 65734
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| || |||||||||| ||||||| |||| || || |||| ||| ||||| ||||||| | |||| |
|
|
| T |
65835 |
tagggatattgcatattatatgtaggggttggggttcgaatcccggacactccacttcttcacaatttaattgtgtgagctctaatcactaggctacttg |
65736 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
65735 |
ac |
65734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 236403 - 236314
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactagg |
163 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||| ||||||||||| | ||||| |||||| |||||||||| ||| | ||||||||||| |
|
|
| T |
236403 |
tagggatattgcatattat--gcaggggtcggggttcgaaccccggacaccccacttatccaca-ttaaaatgtgtgagctttaaccactagg |
236314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 72 - 139
Target Start/End: Complemental strand, 28869 - 28801
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaa |
139 |
Q |
| |
|
|||||| ||| |||| | ||||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
28869 |
tagggacattacatactttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaa |
28801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 140
Target Start/End: Complemental strand, 1774 - 1705
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||| ||||||||||| | ||| ||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
1774 |
tagggatattacatattatatgtaagggttggggttcgaaccccggacactccacttctccacaattaaa |
1705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 173
Target Start/End: Complemental strand, 20241 - 20138
Alignment:
| Q |
72 |
tagggatatt-gcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgctt |
169 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |||| ||| |||| |||||||| ||||||| |||| || || |||| ||||| || |||||||||| ||| |
|
|
| T |
20241 |
tagggatatttgcattttatatgcaggggtcgggtttcgaaccacggacactccacttcttcacaatttaattgtgtgagatttagccactaggttactt |
20142 |
T |
 |
| Q |
170 |
gacc |
173 |
Q |
| |
|
|||| |
|
|
| T |
20141 |
gacc |
20138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 162
Target Start/End: Complemental strand, 50049 - 49958
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc-acttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| ||| |||||||||| ||||||||||| || || |||| ||| |||||| ||||| |
|
|
| T |
50049 |
tagggatattgcatattatatgtaggggttagggttcgaactccggacactctacttctccacaatttaattgtgtgagctctaactactag |
49958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 69 - 162
Target Start/End: Complemental strand, 94035 - 93939
Alignment:
| Q |
69 |
agctagggatattgc--atattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| ||||||| ||| ||||||| | |||||||||||| ||||| ||| ||| |||| ||||||| |
|
|
| T |
94035 |
agctagggatattgcatatattatatgtaggggttggggttcgaactccggacaccccacttctccacaattaaattgtatgagctctagccactag |
93939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 72 - 123
Target Start/End: Complemental strand, 266745 - 266694
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| || ||| ||||||| |
|
|
| T |
266745 |
tagggatattgcatattatatgcaggagccggggttcgaaacccagacactc |
266694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 108424 - 108388
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| |
|
|
| T |
108424 |
tattatatgcaggggctgaggttcaaaccccggacac |
108388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 3009 - 2961
Alignment:
| Q |
73 |
agggatattgcatattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
3009 |
agggacattgcataatttatgcaggggccggggttcgaaccccggacac |
2961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 7108 - 7144
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7108 |
tattatatgcaggggccggggttcgaaccccggacac |
7144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 121
Target Start/End: Complemental strand, 6696 - 6660
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6696 |
tattatatgcaggggccggggttcgaaccccggacac |
6660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 172
Target Start/End: Complemental strand, 8964 - 8861
Alignment:
| Q |
72 |
tagggatattgcatattatatgc--aggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactaggttgct |
168 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |||| | |||| |||| |||| |||| ||||| |||| ||| |||| |||||||| | || |
|
|
| T |
8964 |
tagggatattgcatattatatgcagaggggtcggggttcgaacctcagacacctcatttcttcacaattaaattgtgtgagttctagccactaggctact |
8865 |
T |
 |
| Q |
169 |
tgac |
172 |
Q |
| |
|
|||| |
|
|
| T |
8864 |
tgac |
8861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 76 - 162
Target Start/End: Complemental strand, 59222 - 59136
Alignment:
| Q |
76 |
gatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccactag |
162 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || | ||||| | || || |||||||||||||| || ||| |||||||||||| |
|
|
| T |
59222 |
gatattgcatattatatgcagggg-cggggttcgaatcttggacaccccatttttccacatttaaaatttgtgagctctaaccactag |
59136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 85 - 123
Target Start/End: Original strand, 4355 - 4393
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacactc |
123 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
4355 |
tattatatgcaggggtcggggttcgaaccccggacactc |
4393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 84 - 161
Target Start/End: Original strand, 45944 - 46022
Alignment:
| Q |
84 |
atattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||| |||||||| | |||| |||||| |||||||||||| || || |||| ||| |||| |||||| |
|
|
| T |
45944 |
atattatatgcaggggtcggggttcgagccccagacactccacttctccacaatttaattgtgtgagttctagccacta |
46022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 39668 - 39758
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaaatgtgcgagatctaaccacta |
161 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| | |||| || | | ||||||| |||| ||||| |||| ||| |||||| |||| |
|
|
| T |
39668 |
tagggatattgcatattatatgcaggggttggggttcgagccccagataccccacttcttcacaattaaattgtgtgagctctaactacta |
39758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 25058 - 25094
Alignment:
| Q |
85 |
tattatatgcaggggccggggttcaaaccccggacac |
121 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
25058 |
tattatatgcaggggctggggttcgaaccccggacac |
25094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 75 - 140
Target Start/End: Original strand, 94676 - 94742
Alignment:
| Q |
75 |
ggatattgcatattatatgcaggggccggggttcaaaccccggaca-ctcacttctccacatttaaa |
140 |
Q |
| |
|
||||||||||| | ||||||||||| | |||||| ||||||||||| |||||| ||||||| ||||| |
|
|
| T |
94676 |
ggatattgcatgtcatatgcaggggtcagggttcgaaccccggacacctcactcctccacaattaaa |
94742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0999 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0999
Description:
Target: scaffold0999; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 140
Target Start/End: Original strand, 2197 - 2266
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacac-tcacttctccacatttaaa |
140 |
Q |
| |
|
|||||||||| |||| ||||| || | | ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
2197 |
tagggatattacataatatatacatgagttggggttcaatccccggacacctcacttctccacatttaaa |
2266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 132
Target Start/End: Original strand, 21286 - 21347
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctcca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||| |||||| |||| | |||||||||| |
|
|
| T |
21286 |
tagggatattgcatattatatgcaggggttgggtttcgaaccccagacattccacttctcca |
21347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 172
Target Start/End: Original strand, 8843 - 8943
Alignment:
| Q |
72 |
tagggatattgcatattatatgcaggggccggggttcaaaccccggacact-cacttctccacatttaaaatgtgcgagatctaaccactaggttgcttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||| ||||||| ||| | || ||||||||| ||||| |||| ||| |||| ||| |||| | |||| |
|
|
| T |
8843 |
tagggatattgcattttatatgca-gggtcggggttcgaaccccgaacaatccatttctccacaattaaattgtgtgagctctagccattaggctacttg |
8941 |
T |
 |
| Q |
171 |
ac |
172 |
Q |
| |
|
|| |
|
|
| T |
8942 |
ac |
8943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University