View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1307_high_28 (Length: 265)

Name: NF1307_high_28
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1307_high_28
NF1307_high_28
[»] chr5 (1 HSPs)
chr5 (1-193)||(7762809-7763001)


Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 7763001 - 7762809
Alignment:
1 gtccggtgtaacggataaaacggtgtttgggaggatggaacattggttggtgaagagcgagatgaagcgttgttcgattgaagaggatgcttttatggag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
7763001 gtccggtgtaacggataaaacggtgtttgggaggatggaacattggttggtgaagagcgagatgaagcgttgttcgattgaagaggatgctttgatggag 7762902  T
101 agttgttgggagataagggttttgatgagagagaagaaaggtgtgatagcgtttgagtttgagaattggggtggagggaaggtgttgatgatg 193  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7762901 agttgttgggagattagggttttgatgagagagaagaaaggtgtgatagcgtttgagtttgagaattggggtggagggaaggtgttgatgatg 7762809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University