View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1307_low_22 (Length: 370)
Name: NF1307_low_22
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1307_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 109 - 305
Target Start/End: Complemental strand, 38371107 - 38370914
Alignment:
| Q |
109 |
caatctatgttgtgttggtatttgaatgatagtttattagtattactgttgccgattgccattagttacttcaatgtttgtttgtttgggttacatgata |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38371107 |
caatctatgttgtgttggtatttgaatgatagtttatta---ttactgttgccgattgcgattagttacttgaatgtttgtttgtttgggttacatgata |
38371011 |
T |
|
| Q |
209 |
ttggtacaaagtttccaccaccgctcagcagtgggtaatctttttagagaatagagaatacgtgggacacacaaggtgcgttctcctctgtcaactg |
305 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38371010 |
ttggtacaaagtttccagcaccgctcagcagtgggtaatctttttagagaatagagaatacgtgggacacacaaggtgcgttctcctctgtcaactg |
38370914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 323 - 362
Target Start/End: Complemental strand, 38370915 - 38370876
Alignment:
| Q |
323 |
tgagccgggaaccgaaccacatgcttaaaatggtccaaat |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38370915 |
tgagccgggaaccgaaccacatgcttaaaagggtccaaat |
38370876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University