View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1307_low_28 (Length: 317)
Name: NF1307_low_28
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1307_low_28 |
 |  |
|
| [»] scaffold0179 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0179 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 184 - 239
Target Start/End: Original strand, 2396 - 2451
Alignment:
| Q |
184 |
ttaacaggggaggttacttgcgaaaggtggaccaacatgatttcaaaggacatttt |
239 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
2396 |
ttaacaggggaggttacttgcaaaaggtggaccaacatgttttcaaaggacatttt |
2451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 307
Target Start/End: Original strand, 2456 - 2495
Alignment:
| Q |
268 |
tagaatataagctagcaggatttcatgtttttcgcctatg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2456 |
tagaatataagctagcaggatttcatgtttttcgcttatg |
2495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 236 - 271
Target Start/End: Original strand, 2484 - 2519
Alignment:
| Q |
236 |
ttttcgcttatggttctgttgtgatcttgtgataga |
271 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2484 |
ttttcgcttatggttctgttgtgattttgtgataga |
2519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University