View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1307_low_36 (Length: 262)
Name: NF1307_low_36
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1307_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 23 - 228
Target Start/End: Original strand, 30599586 - 30599791
Alignment:
| Q |
23 |
ccaactaaatggtcgcctcaattaagataatacgttagtgttgagtatctccgttgacaaaaagtttcatggtactttatgtgttcatgactatcgctac |
122 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30599586 |
ccaactaaatggtcgcctcaattatgataatacgttagtgttgagtatctccgttgacaaaaaatttcatggtacgttatgtgttcatgactatcgctac |
30599685 |
T |
 |
| Q |
123 |
aaaatattgatcatggactgaaagctgccaataaacccaaaaagaaatttgctctttatacatctagtaattattcgcagacacctcaaactattaaaac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30599686 |
aaaatattgatcatggactgaaagctgccaataaacccaaaaagaaatttgctctttatacatctagtaattattcgcagacacctcaaactattaaaac |
30599785 |
T |
 |
| Q |
223 |
taccat |
228 |
Q |
| |
|
|||||| |
|
|
| T |
30599786 |
taccat |
30599791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University