View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1307_low_37 (Length: 261)
Name: NF1307_low_37
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1307_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 53384128 - 53383911
Alignment:
| Q |
16 |
ataaaccgggtagaataactgatagagtacaacggaccatcatgatggcaactgcattgccgttcgatctttaaagctttaacaaatacagtacataact |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53384128 |
ataaagcgggtagaataactgatagagtacaatggaccatcatgatggcaactgcatagccgttcgatctttaaagctttaacaaatacagtacataact |
53384029 |
T |
|
| Q |
116 |
cnnnnnnngccgctcaaactctttcttacttcattcactggcggcggcttcagctgagggcttctctgaactttgctctattcgaagcatctccgaagca |
215 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53384028 |
ctttttttgccgctcaaactctttcttacttcattcactggtggcggcttcagctgagggcttctctgaactttgctctattcgaagcatctccgaagca |
53383929 |
T |
|
| Q |
216 |
atcgcgacttcttctaga |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
53383928 |
atcgcgacttcttctaga |
53383911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University