View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1307_low_39 (Length: 253)
Name: NF1307_low_39
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1307_low_39 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 30 - 253
Target Start/End: Original strand, 39384465 - 39384688
Alignment:
| Q |
30 |
caatattgcaggaaagagaattgcaagtgctccacctagactgtgaccagtcaatagaaactttgctttatcatttcttttcaaatgcgtctttagtaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39384465 |
caatattgcaggaaagagaattgcaagtgctccacctagactgtgaccagtcaatagaaactttgctttatcatttcttttcaaatgcgtctttagtaaa |
39384564 |
T |
 |
| Q |
130 |
tctctaatgaagtagtaagcttcaagtgtatggctatgatttgtttcaatttgtttaggccaacccatgttgcttctttgtaaacctaaagctttcatga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39384565 |
tctctaatgaagtagtaagcttcaagtgtatggctatgatttgtttcaatttgttttggccaacccatgttgcttctttgtaaacctaaagcttccatga |
39384664 |
T |
 |
| Q |
230 |
aaccagcatgagtttttccaagtc |
253 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39384665 |
aaccagcatgagtttttccaagtc |
39384688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University