View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308-Insertion-2 (Length: 213)
Name: NF1308-Insertion-2
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308-Insertion-2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 4 - 213
Target Start/End: Original strand, 50897656 - 50897864
Alignment:
| Q |
4 |
aacacaaagttgggatgaacccaacccaattcaaacaaaatgcatcagaggatttcttttcccacccctcgaacttctcacatgccctctaaaattccca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
50897656 |
aacacaaagttgggatgaacccaacccaattcaaacaaaatgcatcagagaatttcttttcccacccctcgaactactca-atgccctctaaaattccca |
50897754 |
T |
|
| Q |
104 |
tttccggggacaactatatgtgtaacggagtatagaactattggagaagctacatttagattataaactatatgtctaagaccggcaggttttgatttgc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50897755 |
tttccggggacaactatatgtgtaacggagtatagaactattggagaagctacatttagattataaactatatgtctaaggccggcaggttttgatttgc |
50897854 |
T |
|
| Q |
204 |
tataagctta |
213 |
Q |
| |
|
|||||||||| |
|
|
| T |
50897855 |
tataagctta |
50897864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University