View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13081_high_7 (Length: 238)
Name: NF13081_high_7
Description: NF13081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13081_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 9935965 - 9935860
Alignment:
| Q |
1 |
tttataatgtcaaaaataaaacatagacaaaaaactaattgtctcatatcttgtgttgcattgagaaaattatgataagc-aaatcattagttgattaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9935965 |
tttataatgtcaaaaataaaacatagacaaaaaattaattgtctcatatcttgtgttgcattgagaaaattatgataagcaaaatcattagttgattaaa |
9935866 |
T |
|
| Q |
100 |
tttatg |
105 |
Q |
| |
|
|||||| |
|
|
| T |
9935865 |
tttatg |
9935860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 9966129 - 9966024
Alignment:
| Q |
1 |
tttataatgtcaaaaataaaa-catagacaaaaaactaattgtctcatatcttgtgttgcattgagaaaattatgataagcaaatcattagttgattaaa |
99 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9966129 |
tttataatgtcaaaaataaaaacatagacaaaaaattaattgtctcatatcttgtgttgcattgagaaaattatgataagcaaatcattagttgattaaa |
9966030 |
T |
|
| Q |
100 |
tttatg |
105 |
Q |
| |
|
|||||| |
|
|
| T |
9966029 |
tttatg |
9966024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 141 - 238
Target Start/End: Complemental strand, 9935823 - 9935726
Alignment:
| Q |
141 |
ttagaattatacattcattataattctagaaacatgaatagtttaactatgagaacattttatataaaattccgagttcctatccgggtcaccatatt |
238 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
9935823 |
ttagaattacacattcattataattctaaaaacatgaatagtttagctatgagaacgttttatatgaaattccgagttcctatccgggttaccatatt |
9935726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 143 - 238
Target Start/End: Complemental strand, 9965985 - 9965894
Alignment:
| Q |
143 |
agaattatacattcattataattctagaaacatgaatagtttaactatgagaacattttatataaaattccgagttcctatccgggtcaccatatt |
238 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
9965985 |
agaattacacattcattataattctagaaacatgaatagtttagctatgataacattttatatgaaattccgagttc----ccgggtcaccatatt |
9965894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University