View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13082_high_12 (Length: 235)
Name: NF13082_high_12
Description: NF13082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13082_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 38076564 - 38076422
Alignment:
| Q |
6 |
tggagaaataaaccagaccttgaaagctacatgagacttgcatgtgtttttaattgtgattgcactcctaacttgcttaccaggttcatcttcaaaacaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38076564 |
tggagaaataaaccagaccttgaaagctacatgagacttgcatgtgtttttaattgtgattgcactcctaacttgcttaccaggttcatcttcaaaacaa |
38076465 |
T |
 |
| Q |
106 |
aaccacacattaatcagagtcagtttgcaaaaatctcctaatc |
148 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38076464 |
aaccacacattaatcagagtcagtttacaaaaatctcctaatc |
38076422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 199
Target Start/End: Complemental strand, 38076422 - 38076387
Alignment:
| Q |
164 |
caaattaatcgattcttgggctagatatcgagtttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38076422 |
caaattaatcgattcttgggctagatatcgagtttc |
38076387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University