View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13082_low_10 (Length: 238)
Name: NF13082_low_10
Description: NF13082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13082_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 45934582 - 45934736
Alignment:
| Q |
71 |
ctggacagattggaagcggtggatgggaaaccagggtggtattgttattccatctgatcaaagctgggaatcttggtgggatgaagaaaatgaacacctg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45934582 |
ctggacagattggaagcggtggatgggaaaccagggtggtattggtattccatctgatcaaagctgggaatcttggtgggatgaagaaaatgaacatctg |
45934681 |
T |
|
| Q |
171 |
aaatactccaatgtccgagggaaaatacttgagattgttcttgcatgtcgtttct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45934682 |
aaatactccaatgtccgagggaaaatacttgagattgtttttgcatgtcgtttct |
45934736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 45934437 - 45934506
Alignment:
| Q |
1 |
ttatgaagtctatggcgaatcatatcgaagctcgactcttaatttccttatcacaatctcaatgtggttt |
70 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934437 |
ttatgaagtctatggtgaatcatatcgaagctcgactcttaatttccttatcacaatctcaatgtggttt |
45934506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 78 - 217
Target Start/End: Original strand, 15816822 - 15816961
Alignment:
| Q |
78 |
gattggaagcggtggatgggaaaccagggtggtattgttattccatctgatcaaagctgggaatcttggtgggatgaagaaaatgaacacctgaaatact |
177 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15816822 |
gattggaagcggtggatgggaaaccgtggtggtattggtattccatctgataaaagctgggaatcttggtgggatgaagaaaatgaacacctgaaatact |
15816921 |
T |
|
| Q |
178 |
ccaatgtccgagggaaaatacttgagattgttcttgcatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15816922 |
ccaatgtccgagggaaaatacttgagattgttcttgcatg |
15816961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 15816671 - 15816740
Alignment:
| Q |
1 |
ttatgaagtctatggcgaatcatatcgaagctcgactcttaatttccttatcacaatctcaatgtggttt |
70 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
15816671 |
ttatgaagtctatggcgaatcataccgaagctcaactctttatttcttcatcacaatctcaatgtggttt |
15816740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University