View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13083_high_9 (Length: 257)
Name: NF13083_high_9
Description: NF13083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13083_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 30 - 240
Target Start/End: Original strand, 42929043 - 42929253
Alignment:
| Q |
30 |
ctatagagatggggaagnnnnnnncattgaacatctcttctcttctcaaaaacacagaactcaaatattcatcttcttcttcatcatggccatggccata |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929043 |
ctatagagatggggaagaaaaaaacattgaacatctcttctcttctcaaaaacacagaactcaaatattcatcttcttcttcatcatggccatggccata |
42929142 |
T |
|
| Q |
130 |
ttgtcaccaaccaaaaacactctcttttagagctgataacatcaacaaagatgacactttcaaaaccattaactcagtttacttggacgcttctgaatcc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42929143 |
ttgtcaccaaccaaaaacactctcttttagagctgataacatcaacaaagatgacactttcaaaaccattaactcagtttacttggatgcttctgaatcc |
42929242 |
T |
|
| Q |
230 |
ttctccactgt |
240 |
Q |
| |
|
||||||||||| |
|
|
| T |
42929243 |
ttctccactgt |
42929253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 25531550 - 25531495
Alignment:
| Q |
107 |
tcttcatcatggccatggccatattgtcaccaaccaaaaacactctcttttagagc |
162 |
Q |
| |
|
||||| |||||| | ||||||| |||| |||||||||||||||| ||||||||||| |
|
|
| T |
25531550 |
tcttcttcatggtcttggccatcttgtaaccaaccaaaaacactttcttttagagc |
25531495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University