View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13083_low_11 (Length: 252)
Name: NF13083_low_11
Description: NF13083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13083_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 11 - 234
Target Start/End: Complemental strand, 49704387 - 49704164
Alignment:
| Q |
11 |
catcatcaacagaagactaatctattnnnnnnnntcaatagaagaccaaaggctaagtcaaatattgactaaagactaagtcaaataaactactagtatc |
110 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49704387 |
catcaccaacataagactaatctattaaaaaaaatcaatagaagaccaaaggctaagtcaaatattgactaaagactaagtcaaataaactactagtatc |
49704288 |
T |
 |
| Q |
111 |
taataccttcaccaaacgttcatagagtgccctctcttattccattcacccaaggttcactcttctatttcnnnnnnnnnnnnnncacattttatttctc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49704287 |
taataccttcaccaaacgttcatagagtgccctctcttattccattcacccaaggttcactcttctatttctttttttggtttttcacattttatttctc |
49704188 |
T |
 |
| Q |
211 |
cattctctttccttatgctcttgc |
234 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49704187 |
cattctctttccttatgctcttgc |
49704164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University