View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13083_low_12 (Length: 214)

Name: NF13083_low_12
Description: NF13083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13083_low_12
NF13083_low_12
[»] chr2 (1 HSPs)
chr2 (107-206)||(33634151-33634250)
[»] chr8 (1 HSPs)
chr8 (110-193)||(29191591-29191683)


Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 107 - 206
Target Start/End: Original strand, 33634151 - 33634250
Alignment:
107 tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttcttctctctcg 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
33634151 tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttcttttctctcg 33634250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 193
Target Start/End: Complemental strand, 29191683 - 29191591
Alignment:
110 tgcgaacgaaatttcccactcgtcactcagtgagt---------ttgatcttactgcaactgttcccgccatttgtttgaattatctcttttc 193  Q
    |||||| ||||||||||||||||||||||||||||         ||||||| |||||||||||||||||||||| |||||||| |||| ||||    
29191683 tgcgaaggaaatttcccactcgtcactcagtgagtttgttgttgttgatctcactgcaactgttcccgccatttttttgaattctctcctttc 29191591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University