View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13083_low_12 (Length: 214)
Name: NF13083_low_12
Description: NF13083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13083_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 107 - 206
Target Start/End: Original strand, 33634151 - 33634250
Alignment:
| Q |
107 |
tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttcttctctctcg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33634151 |
tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttcttttctctcg |
33634250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 193
Target Start/End: Complemental strand, 29191683 - 29191591
Alignment:
| Q |
110 |
tgcgaacgaaatttcccactcgtcactcagtgagt---------ttgatcttactgcaactgttcccgccatttgtttgaattatctcttttc |
193 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||| |||| |||| |
|
|
| T |
29191683 |
tgcgaaggaaatttcccactcgtcactcagtgagtttgttgttgttgatctcactgcaactgttcccgccatttttttgaattctctcctttc |
29191591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University