View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13084_high_8 (Length: 212)
Name: NF13084_high_8
Description: NF13084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13084_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 11 - 185
Target Start/End: Original strand, 9630139 - 9630313
Alignment:
| Q |
11 |
cgaagaatattagcctggccattatttgcaagggaaccaaatgcagttccacttagatcaaactggataggtgcacatccagggcaactatcagtgatca |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9630139 |
cgaagattattagcctggccattatttgcaagggaaccaaatgcagttccacttagatcaaactggataggtgcacatccagggcaactatcagtgatca |
9630238 |
T |
 |
| Q |
111 |
tcacagtcacaggatttcttgagcatgcactattttctgtgcatttcacctgaaaattaatcaaacatccaatta |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9630239 |
tcacagtcacaggatttcttgagcatgcactattttctgtgcatttcacctgaaaattaatcaaacatccaatta |
9630313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 34 - 167
Target Start/End: Original strand, 17444285 - 17444418
Alignment:
| Q |
34 |
atttgcaagggaaccaaatgcagttccacttagatcaaactggataggtgcacatccagggcaactatcagtgatcatcacagtcacaggatttcttgag |
133 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||| ||| || | ||||| | |||||| |||| || |||| |||| |||| ||| ||| |||| |
|
|
| T |
17444285 |
atttgcaagggaaccaaaggcagttccacttaaatcaaaatgggcagattcacattcggggcaattatctgttatcaccacattcactggacttcctgag |
17444384 |
T |
 |
| Q |
134 |
catgcactattttctgtgcatttcacctgaaaat |
167 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
17444385 |
catgcactattttcggtgcatttcacctgaaaat |
17444418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University