View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13085_high_13 (Length: 341)
Name: NF13085_high_13
Description: NF13085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13085_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 173 - 276
Target Start/End: Original strand, 34361320 - 34361423
Alignment:
| Q |
173 |
gtttattatgttcacacctatccgacacccagacacatgcatccaatggtttttaatacaaaacttactccataaaactactcatgcatgcttgctttgt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34361320 |
gtttattatgttcacacctatccgacacccagacacatgcatccaatggtttttaatacaaaacttactccataaaactactaatgcatgcttgctttgt |
34361419 |
T |
|
| Q |
273 |
gttc |
276 |
Q |
| |
|
|||| |
|
|
| T |
34361420 |
gttc |
34361423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 43 - 126
Target Start/End: Original strand, 34361192 - 34361273
Alignment:
| Q |
43 |
ttgttgaccagactctgtctcatcatgtttaccatcaggtgcctgtgttactccttataccttcacaactgccattgatccaga |
126 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34361192 |
ttgttgaccagact--gtttcatcatgtttaccatcaggtgcctgtgttactccttataccttcacaactgccattgatccaga |
34361273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 55 - 130
Target Start/End: Original strand, 37166977 - 37167052
Alignment:
| Q |
55 |
ctctgtctcatcatgtttaccatcaggtgcctgtgttactccttataccttcacaactgccattgatccagagaag |
130 |
Q |
| |
|
||||||||||| || |||||||||| ||||||||||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
37166977 |
ctctgtctcattatatttaccatcacgtgcctgtgttcctccttataccatcacaactgccattgatctagagaag |
37167052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 55 - 130
Target Start/End: Complemental strand, 12118431 - 12118356
Alignment:
| Q |
55 |
ctctgtctcatcatgtttaccatcaggtgcctgtgttactccttataccttcacaactgccattgatccagagaag |
130 |
Q |
| |
|
|||||| |||| || |||||||||| ||||||||||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
12118431 |
ctctgtttcattatatttaccatcacgtgcctgtgttcctccttataccatcacaactgccattgatctagagaag |
12118356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University