View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13085_high_18 (Length: 290)
Name: NF13085_high_18
Description: NF13085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13085_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 33168784 - 33168501
Alignment:
| Q |
1 |
ttgccaaacttgtgtagctaaagggtaatcaaacactacatgtacagggtcttcatgtgcagaatcacaactaaaacaatttgtgcagcactgcatgcct |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
33168784 |
ttgccaaacttgtgtagccaaagggtaatcaaacactacatgtacagggtcttcatgtgcagaatcacaactaaaacaatttgtacaacactgcatgcct |
33168685 |
T |
 |
| Q |
101 |
ttatcttaaagacgaactcttgttgacagacaaccgcggcagatacgtcaaactagannnnnnnactttaggtgacactttcaggcatcaaatccccgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33168684 |
ttatcttaaagacgaactcttgttgacaaacaaccgcggcacatacgtcaaactaga-ttttttactttaggtgacactttcaggcatcaaatccccgac |
33168586 |
T |
 |
| Q |
201 |
caaaaaccgggtcgacgaatatgggatgtgtcaaccaattccttcacacaaagtcagcgaacacttttaaccgagaataatctac |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
33168585 |
caaaaaccgggtcgacgaatatgggatgtgtcaaccaattccttcacacaaagtcagcgaacacttttaaccgagtataaactac |
33168501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University