View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13085_high_19 (Length: 288)
Name: NF13085_high_19
Description: NF13085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13085_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 281
Target Start/End: Complemental strand, 5037161 - 5036898
Alignment:
| Q |
18 |
attccaattcccataaccttttttctcaacnnnnnnngtgctgtaaatatcagtaacatggttttgaagtgttaccccatccctgttgcgtaagtgtact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5037161 |
attccaattcccataaccttttttctcaactttttttgtgctgtaaatatcagtaacatggttttgaagtgttaccccatccctgttgcgtaagtgtact |
5037062 |
T |
|
| Q |
118 |
gctctgtctgaactacacagcactcatactctagttcctatctgatgttgatggccctgaagctccaataagtcataatttcataaagcaaatggtttgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5037061 |
gctctgtctgaactacacagcactcatactctagttcctttctgatgttgatggccctgaagctccaataagtcataatttcataaagcaaatggtttgg |
5036962 |
T |
|
| Q |
218 |
ttttataacatgtttatgtgtgcatggttttacaccagcaattagcaacactctacttcttttc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5036961 |
ttttataacatgtttatgtgtgcatggttttacaccagcaattagcaacactctacttcttttc |
5036898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University