View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13085_low_23 (Length: 256)

Name: NF13085_low_23
Description: NF13085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13085_low_23
NF13085_low_23
[»] chr1 (1 HSPs)
chr1 (17-256)||(23040090-23040327)


Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 256
Target Start/End: Original strand, 23040090 - 23040327
Alignment:
17 tatatttaagatcgaaataggaaaaattatattaaatatttgccactatgtggaatactatggtcatttcatggaaggtaaatggaaaaatcagtgtcta 116  Q
    |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23040090 tatatttaagatcgaattagcaaaaattatattaaatatttgccactatgtggaatactatggtcatttcatggaaggtaaatggaaaaatcagtgtcta 23040189  T
117 catccattctcccccaccacaagatacccatatatacacataaaatttacaacttcataacaattggcatttctttattctataataatgataaataata 216  Q
    ||||||||||||||| |||||||||| ||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23040190 catccattctccccctccacaagatatcc--atatacacataaaatttacaacttcataacaattggcatttctttattctataataatgataaataata 23040287  T
217 atcaaaatattggaggggaccattgattaaatattaattt 256  Q
    ||||||||||||||||||||||||||||||||||||||||    
23040288 atcaaaatattggaggggaccattgattaaatattaattt 23040327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University