View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13085_low_26 (Length: 247)
Name: NF13085_low_26
Description: NF13085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13085_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 35025795 - 35026032
Alignment:
| Q |
1 |
ttcttattttgttgtaagttgcaaccttctctaaatgactaaaacttactgcatttcattaaaaataattgtctcaatacaatgtggacnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35025795 |
ttcttattttgttgtaagttgcaaccttctctaaatgactaaaacttactgcatttcattaaaaataattgtctcaatacaatgtggacaaaaataaaaa |
35025894 |
T |
|
| Q |
101 |
ntttggcgattagcaaaaaagcttgatgcccaagctaactcatggaccactcgattaacttgtctcctaacgaaattgaccccgcaattgtgattcgtat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35025895 |
atttggcgattagcaaaaaagcttgatgcccaagctaactcatggaccactcgattaacttgtctcctaacgaaattgaccccgcaattgtgattcatat |
35025994 |
T |
|
| Q |
201 |
ttagtacttctctacacttctcactaattctccatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35025995 |
ttagtacttctctacacttctcactaattttccatatt |
35026032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 172 - 238
Target Start/End: Complemental strand, 36863026 - 36862960
Alignment:
| Q |
172 |
gaaattgaccccgcaattgtgattcgtatttagtacttctctacacttctcactaattctccatatt |
238 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
36863026 |
gaaattgaccctgcagttgtgattcatatttagtagttttctacgtttctcactaattctccatatt |
36862960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University