View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13085_low_28 (Length: 238)
Name: NF13085_low_28
Description: NF13085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13085_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 40839550 - 40839331
Alignment:
| Q |
19 |
aatccagggaatagggctgaaatgattggaacaaaggcaatcatagggatcagataccatggtacatatttgccagttggtacctatgatgttactaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839550 |
aatccagggaatagggctgaaatgattggaacaaaggcaatcatagggatcagataccatggtacatatttgccagttggtacctatgatgttactaaag |
40839451 |
T |
|
| Q |
119 |
gaaccaaaagaggttgcagtcttttacctaccgatattggccttaatgtgtcagatatgtcgattcaacatgatcaagggtcaaatttttatactatcta |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839450 |
gaaccaaaagaggttgtagtcttttacctaccgatattggccttaatgtgtcagatatgtcgattcaacatgatcaagggtcaaatttttatactatcta |
40839351 |
T |
|
| Q |
219 |
tgctagattagttttgcctt |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40839350 |
tgctagattagttttgcctt |
40839331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University