View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13085_low_31 (Length: 227)
Name: NF13085_low_31
Description: NF13085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13085_low_31 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 227
Target Start/End: Complemental strand, 23040649 - 23040431
Alignment:
| Q |
9 |
tatacgtgaattattcgtatcttaggtttcatttttgatattttgtgggaatttttatgcatatctaggaaattaggttggtttgaatttgatatgcatg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23040649 |
tatacgtgaattattcgtatcttaggtttcatttttgatattttgtgagaatctttatgcatagctaggaaattaggttggtttgaatttgatatgcatg |
23040550 |
T |
|
| Q |
109 |
tataattagggtttctaagcttgttttccattgagaatcaaaagaaaaaggaataagaagggtttataaaagtttatattgaagagtagttagaaagaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23040549 |
tataattagggtttctaagcttgttttccattgagaatcaaaagaaaaaggaataagaagggtttatgaaagtttatattgaagagtagttagaaagaaa |
23040450 |
T |
|
| Q |
209 |
gcaaaaaggaaatcatata |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
23040449 |
gcaaaaaggaaatcatata |
23040431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University