View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13085_low_32 (Length: 224)
Name: NF13085_low_32
Description: NF13085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13085_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 2555687 - 2555521
Alignment:
| Q |
18 |
ataagaataaaatcatgtaataaaaacttgttggatcaagatggtaaagaggagaggtcgctgacctgatacctggaagaagacaaaacattattttcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2555687 |
ataagaataaaatcatgtaataaaaacttgttggatcaagatggtaaagaggagaggtcgttgacctgatacatggaagaagacaaaacattattttcat |
2555588 |
T |
 |
| Q |
118 |
tttcataacagatgcaaacttccaaagatgaaagtgaagtgaggcatacaacgtattgaagagaaaa |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2555587 |
tttcataacagatgcaaacttccaaagatgaaagtgaagtgaggcatacaacgcattgaagagaaaa |
2555521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University