View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13088_high_5 (Length: 338)
Name: NF13088_high_5
Description: NF13088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13088_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 11 - 322
Target Start/End: Original strand, 3437705 - 3438007
Alignment:
| Q |
11 |
taattcttatctttgatttcttccctttgcttgaagtacttgaccttagtaagagtgacaacaaccgtttccaacctacacagagtaaatgctatgtcgc |
110 |
Q |
| |
|
|||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3437705 |
taattcttatctctgattgcttccctttacttgaagtacttgaccttagtaagagtgacaacgaccgtttccaatctacacagagtaaatgctatgtcgc |
3437804 |
T |
|
| Q |
111 |
ttcctaagcttcgtaaggttaatctctccggtcactgccatgcaatcgactcattgcttatgcacttgtgtaagaattgtgagtttcttgaggaagttac |
210 |
Q |
| |
|
|| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3437805 |
tt---------cgtaaggttaatctctccggtcattgccatgctatcgactcattgcttatgcacttgtgtaagaattgtgaatttcttgaggaagttac |
3437895 |
T |
|
| Q |
211 |
gataatgaattgctcatccataacttgcattggcattgcttgtgcaaatcgagagagaccaactttgaagtctatatccattacatggagatcaattaaa |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3437896 |
gataatgaattgctcatccataacttgcattggcattgcttctgcaaatcgagagagaccaactttgaagtctatatccattacatggagatcaattaaa |
3437995 |
T |
|
| Q |
311 |
ccccggtataac |
322 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3437996 |
ccccggtataac |
3438007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 191
Target Start/End: Original strand, 1527362 - 1527444
Alignment:
| Q |
109 |
gcttcctaagcttcgtaaggttaatctctccggtcactgccatgcaatcgactcattgcttatgcacttgtgtaagaattgtg |
191 |
Q |
| |
|
|||||||||||| | |||||||||||||| ||||| | |||||| ||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
1527362 |
gcttcctaagctccacaaggttaatctctctggtcatcactatgcaaatgactcgttgcttttgcacttgtgtaaaaattgtg |
1527444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 158 - 198
Target Start/End: Original strand, 17627231 - 17627271
Alignment:
| Q |
158 |
gactcattgcttatgcacttgtgtaagaattgtgagtttct |
198 |
Q |
| |
|
|||||||| ||| ||||||||||||| |||||||||||||| |
|
|
| T |
17627231 |
gactcattacttttgcacttgtgtaaaaattgtgagtttct |
17627271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University