View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_high_53 (Length: 325)
Name: NF1308_high_53
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_high_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 6316514 - 6316724
Alignment:
| Q |
1 |
tttattagttatctacattcagatctctgctggaaactaaagattcaaagagtaagagtatggatatatctatcaatcatcacccaccaaatcaaacaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6316514 |
tttattagttatctacattcagatctctgctggaaactaaagattcaaagagtaagagtatggatatatctatcaatcatcacccaccaaatcaagcaga |
6316613 |
T |
 |
| Q |
101 |
gatatcatatcagactttataaataggaaactaaagatcaatgcaaatagagaaaaataaccatattcactgccgaaaactatatcataacctcagtctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316614 |
gatatcatatcagactttataaataggaaactaaagatcaatgcaaatagagaaaaataaccatattcactgccgaaaactatatcataacctcagtctg |
6316713 |
T |
 |
| Q |
201 |
catcatattga |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
6316714 |
catcatattga |
6316724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University