View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_high_61 (Length: 287)
Name: NF1308_high_61
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_high_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 52 - 257
Target Start/End: Complemental strand, 27813622 - 27813415
Alignment:
| Q |
52 |
aactttacctgaaatattgataactttctgaaatagttttaagaggagctattagaaacctctaatagcgtaaaggtatcctttctgtttgcattgataa |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27813622 |
aactttacctgaaatattgataactttctgaaatagttttaagag---ctattagaaacctccaatagtgtaaaggtatcctttctgtttgcattgataa |
27813526 |
T |
 |
| Q |
152 |
tattgcatact-----tttagattttttgttgttagtcgcagattttgattaatttaagattaattaagctctttatcctatatctgcttataaatgatt |
246 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27813525 |
tattgcatactctggttttagattgtttgttgttagtcgcagattttgattaatttaagattaattaagctctttatcctatatctgcttataaatgatt |
27813426 |
T |
 |
| Q |
247 |
tttgccctatg |
257 |
Q |
| |
|
|||||| |||| |
|
|
| T |
27813425 |
tttgccttatg |
27813415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 6761872 - 6761839
Alignment:
| Q |
119 |
gcgtaaaggtatcctttctgtttgcattgataat |
152 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
6761872 |
gcgtaaaggtaccctttctgtttgcattgataat |
6761839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University