View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_high_65 (Length: 283)
Name: NF1308_high_65
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_high_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 14 - 151
Target Start/End: Original strand, 4378734 - 4378869
Alignment:
| Q |
14 |
agagaggaagaggtcatcacacacagtgacttgacagaaaaaagaagaacaagttgaagttgaactacagtgtgtggtccatgaagaaaacttaagtgat |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4378734 |
agagaggaagaggtca-cacacacagtgacttgacagaaaaaagaagaacaagttgaagttgaactacagtgtgtggtccatgaagaaaactt-agtgat |
4378831 |
T |
|
| Q |
114 |
tttagtctcatttttggtgcagacagaacggtgggaac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4378832 |
tttagtctcatttttggtgcagacagaacggtgggaac |
4378869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 213 - 255
Target Start/End: Original strand, 4378931 - 4378973
Alignment:
| Q |
213 |
cgtgcatggtggactttatagcagaggatcaaggccctgtctt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4378931 |
cgtgcatggtggactttatagcagaggatcaaggccctgtctt |
4378973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 134
Target Start/End: Original strand, 31714671 - 31714718
Alignment:
| Q |
85 |
gtgtggtccatgaagaaaacttaagtgattttagtctcatttttggtgca |
134 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31714671 |
gtgtggtccatga-gaaaacttat-tgattttagtctcatttttggtgca |
31714718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University