View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_high_71 (Length: 258)
Name: NF1308_high_71
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_high_71 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 230
Target Start/End: Original strand, 50897447 - 50897665
Alignment:
| Q |
13 |
aaaataaaataaaataattaacgatataagctta-ttttgtctttttattttagataagcagcgtacnnnnnnnnnnggataaatacaagagaccactct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
50897447 |
aaaataaaataaaataattaacgatataagcttacttttgtctttttattttagataagcagcgtacttttttttttggataaatacaagagacccctct |
50897546 |
T |
|
| Q |
112 |
gttttaattctccaaagcatcaatatatccaagtttgcttttaatcattttaatttttatctctactcaaaatttcttgaaacgggccaagcctaatcca |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50897547 |
gttttaattctccaaagcatcaatacatccaagtttgcttttaatcattttaatttttatctatgctcaaaatttcttgaaacgggccaagcctaatcca |
50897646 |
T |
|
| Q |
212 |
ataggctaaaacacaaagt |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
50897647 |
ataggctaaaacacaaagt |
50897665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University