View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1308_low_101 (Length: 224)

Name: NF1308_low_101
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1308_low_101
NF1308_low_101
[»] chr8 (1 HSPs)
chr8 (1-208)||(27296616-27296823)
[»] chr5 (2 HSPs)
chr5 (58-108)||(24047906-24047956)
chr5 (69-109)||(29163412-29163452)
[»] scaffold0205 (1 HSPs)
scaffold0205 (56-108)||(21451-21503)


Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 27296616 - 27296823
Alignment:
1 attagcttaatgtgaacaacaaaatttctacggaaaaataggcgtgtatggtgcccgacatgtgtcagtgtctaatattgacatgacacggacacatgtg 100  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
27296616 attagcttaatgtgaacaacaaaatttctatggaaaaataggcgtgtatggtgcccgacatgtgtcactgtctaatattgacatgacacggacacatgtg 27296715  T
101 gttacatttcatcccttctattgtcttaaactattactagtgtctatgtgttgctatcaacgtcacatttgtgtttgtgtctgcgtttcatagtgtgtat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27296716 gttacatttcatcccttctattgtcttaaactattactagtgtctatgtgttgctatcaacgtcacatttgtgtttgtgtctgcgtttcatagtgtgtat 27296815  T
201 gaaatatc 208  Q
    ||||||||    
27296816 gaaatatc 27296823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 58 - 108
Target Start/End: Complemental strand, 24047956 - 24047906
Alignment:
58 acatgtgtcagtgtctaatattgacatgacacggacacatgtggttacatt 108  Q
    |||||| ||||||||||||||||||||||||  ||||||||| ||||||||    
24047956 acatgtttcagtgtctaatattgacatgacaacgacacatgtagttacatt 24047906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 109
Target Start/End: Complemental strand, 29163452 - 29163412
Alignment:
69 tgtctaatattgacatgacacggacacatgtggttacattt 109  Q
    |||||| |||||||| |||||||||||||||| ||||||||    
29163452 tgtctactattgacaagacacggacacatgtgattacattt 29163412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0205 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0205
Description:

Target: scaffold0205; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 108
Target Start/End: Complemental strand, 21503 - 21451
Alignment:
56 cgacatgtgtcagtgtctaatattgacatgacacggacacatgtggttacatt 108  Q
    ||||| |||||||||| |||||||||||  |||| || |||||||||||||||    
21503 cgacacgtgtcagtgtttaatattgacacaacactgatacatgtggttacatt 21451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University