View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_low_101 (Length: 224)
Name: NF1308_low_101
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_low_101 |
 | |
|
| [»] scaffold0205 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 27296616 - 27296823
Alignment:
| Q |
1 |
attagcttaatgtgaacaacaaaatttctacggaaaaataggcgtgtatggtgcccgacatgtgtcagtgtctaatattgacatgacacggacacatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27296616 |
attagcttaatgtgaacaacaaaatttctatggaaaaataggcgtgtatggtgcccgacatgtgtcactgtctaatattgacatgacacggacacatgtg |
27296715 |
T |
|
| Q |
101 |
gttacatttcatcccttctattgtcttaaactattactagtgtctatgtgttgctatcaacgtcacatttgtgtttgtgtctgcgtttcatagtgtgtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27296716 |
gttacatttcatcccttctattgtcttaaactattactagtgtctatgtgttgctatcaacgtcacatttgtgtttgtgtctgcgtttcatagtgtgtat |
27296815 |
T |
|
| Q |
201 |
gaaatatc |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
27296816 |
gaaatatc |
27296823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 58 - 108
Target Start/End: Complemental strand, 24047956 - 24047906
Alignment:
| Q |
58 |
acatgtgtcagtgtctaatattgacatgacacggacacatgtggttacatt |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
24047956 |
acatgtttcagtgtctaatattgacatgacaacgacacatgtagttacatt |
24047906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 109
Target Start/End: Complemental strand, 29163452 - 29163412
Alignment:
| Q |
69 |
tgtctaatattgacatgacacggacacatgtggttacattt |
109 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| |||||||| |
|
|
| T |
29163452 |
tgtctactattgacaagacacggacacatgtgattacattt |
29163412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0205 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0205
Description:
Target: scaffold0205; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 108
Target Start/End: Complemental strand, 21503 - 21451
Alignment:
| Q |
56 |
cgacatgtgtcagtgtctaatattgacatgacacggacacatgtggttacatt |
108 |
Q |
| |
|
||||| |||||||||| ||||||||||| |||| || ||||||||||||||| |
|
|
| T |
21503 |
cgacacgtgtcagtgtttaatattgacacaacactgatacatgtggttacatt |
21451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University