View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_low_102 (Length: 215)
Name: NF1308_low_102
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_low_102 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 5677971 - 5677839
Alignment:
| Q |
1 |
agtctccaagtgtggatacattcggaaactcgtctcagaatctaatgactcggacgtgtcctttgttgaactctccgatgttcctggtggagcagaagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5677971 |
agtctccaagtgtggatacattcggaaactcgtctcagaatctaatgactcggacgtgtcctttgttgaactctccgatgttcctggtggagcagaagca |
5677872 |
T |
|
| Q |
101 |
tttgaactagcagcaaaattctgctacggtata |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5677871 |
tttgaactagcagcaaaattctgctacggtata |
5677839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 66 - 129
Target Start/End: Original strand, 39777502 - 39777565
Alignment:
| Q |
66 |
ttgaactctccgatgttcctggtggagcagaagcatttgaactagcagcaaaattctgctacgg |
129 |
Q |
| |
|
|||||||| |||||| ||||||||| ||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
39777502 |
ttgaactcatcgatgtccctggtggatcagaagcatttgaactagcagcaaagttctgttacgg |
39777565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University