View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_low_26 (Length: 442)
Name: NF1308_low_26
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 85 - 304
Target Start/End: Original strand, 3472723 - 3472942
Alignment:
| Q |
85 |
gatgaatcaaagagagagtgagagggtagggttaatatgtgacagtgaagagcacatggtttgtaagtgttggaaaatgaagaaagagtaaaaatataaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3472723 |
gatgaatcaaagagagagtgagagggtagggttaatatgtgacagtgaagagcacatggtttgtaagtgttggaaaatgaagaaagagtaaaaatataaa |
3472822 |
T |
|
| Q |
185 |
tgtgtataagatgatggaaatgaaatgaagatgagtttgattttgcatgtgaatttggtgaagttacgcaacgtagagtggatggtagtgttttgagaag |
284 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
3472823 |
tgtgtataagatgataaaaatgaaatgaagatgagtttgattttgcatgtgaatttggtgaagttacgcaacgtagagtggattgtagtgttttgggaag |
3472922 |
T |
|
| Q |
285 |
agagagagtgttgtgttgtg |
304 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3472923 |
agagagagtgttgtgttgtg |
3472942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University