View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_low_54 (Length: 349)
Name: NF1308_low_54
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 10366845 - 10366582
Alignment:
| Q |
1 |
gacactggtttctatatgtcttgcagatcttgagtcagagaattccatggctagtgtttcttcatcgctctgttgcatctccatttcttcattgcttgtg |
100 |
Q |
| |
|
|||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10366845 |
gacactggtttctagatgtctagtagatcttgagtcagagaattccatggctagtgtttcttcatcgctctgttgcatctccatttcttcattgcttgtg |
10366746 |
T |
 |
| Q |
101 |
gcctccatcagagagtttcacttgtcagtatatatctgccatgcatgatcaatgatctaaacagcactacatttaactc-taacacacaacatataaata |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10366745 |
gcctccatcagagagtttcacttgtcagtatatatctgccatgcatgatcaatgatctaaacaacactacatttaactcttaacacacaacatataaata |
10366646 |
T |
 |
| Q |
200 |
ttgaatataatatggtttctaatgtcaacaattaatcaattatgtctatatatagccatcaata |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10366645 |
ttgaatataatatggtttctaatgtcaacaattaatcaattatgtctatatatagctatcaata |
10366582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University