View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_low_56 (Length: 340)
Name: NF1308_low_56
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 16 - 265
Target Start/End: Original strand, 2394098 - 2394350
Alignment:
| Q |
16 |
atgagttgctagaatgagtgaatgacgtcttttaatttagagtatgttcctctatttacaaattttaaagactaaaattatctccgtttataatctcaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2394098 |
atgagttgctagaatgagtgaatgacgtcttttaatttcgagtatgttcgtctatttacaaattttaaagactaaaattatctctgtttataatctcaga |
2394197 |
T |
 |
| Q |
116 |
gtctatcttagtggtttattggattgttcctgcaaatactatggnnnnnnnaatggtgttttgttactgcaaagtacaaacaatatgg---nnnnnnnnn |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2394198 |
gtctatcttagtggtttattagattgttcctgcaaatactatggtttttttaatggtgttttgttactgcaaagtacaaacactatggtttttttttttt |
2394297 |
T |
 |
| Q |
213 |
aaatactagcatgtttttccctcataagatgagctgcttaatcagccggaatt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2394298 |
aaatactagcatgtttttccctcataagatgagctccttaatcagccggaatt |
2394350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University