View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_low_68 (Length: 294)
Name: NF1308_low_68
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_low_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 28 - 289
Target Start/End: Original strand, 653600 - 653861
Alignment:
| Q |
28 |
cattagggtacacaaagttccacactttaatagcaaggctattctcatgttcctccacaggttctgacccaattggctttgaaccccagaaaaaaggaca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
653600 |
cattagggtacacaaagttccacactttaatagcaaggctattctcatgttcctccacaggttctgacccaattggctttgaaccccagaaaaaaggaca |
653699 |
T |
 |
| Q |
128 |
acatagtaatgctcccaatattttaagattgtttggtaatgtttcagttccagcacgcatagctaagttatgagcaaggttagcaccgttgacatcacca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
653700 |
acatagtaatgctcccaatattttaagattgtttggtaatgtttcagttccagcacgcatagctaagttatgagcaaggttagcaccgttgacatcacca |
653799 |
T |
 |
| Q |
228 |
cctatgtaaactttgttgaaatcaccagaatcttgtaaccattgttcttttcctatgctact |
289 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
653800 |
cctatgtaaactttgttgaaatcaccataatcttgtaaccattgttctttttctatgctact |
653861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University