View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1308_low_80 (Length: 265)

Name: NF1308_low_80
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1308_low_80
NF1308_low_80
[»] chr4 (1 HSPs)
chr4 (1-179)||(49315196-49315374)
[»] chr7 (1 HSPs)
chr7 (103-151)||(6663208-6663256)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 49315374 - 49315196
Alignment:
1 gctatggaaattgataaagatgctgatgtaaatgttactagtaatacaaatagcaataataatgatgatttgaataagcctttgaaggaggttatttttg 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49315374 gctatggaaattgataaagatactgatgtaaatgttactagtaatacaaatagcaataataatgatgatttgaataagcctttgaaggaggttatttttg 49315275  T
101 tcgatgatgatgataaagaggaaggggagttggaggagggtgagattgatgttgacgacgatacaaattgtgcaattgt 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49315274 tcgatgatgatgataaagaggaaggggagttggaggagggtgagattgatgttgacgacgatacaaattgtgcaattgt 49315196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 103 - 151
Target Start/End: Complemental strand, 6663256 - 6663208
Alignment:
103 gatgatgatgataaagaggaaggggagttggaggagggtgagattgatg 151  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||    
6663256 gatgatgatgaaaaagaggaaggggagttggaggagggtgagattgatg 6663208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University