View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1308_low_88 (Length: 251)
Name: NF1308_low_88
Description: NF1308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1308_low_88 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 46817819 - 46817575
Alignment:
| Q |
13 |
aatatgtgatgcttaatcaaagtaggtcattttggatgccactttataaacatttaatctaa-----aaatgcttagccaaagcccaaattgtgttctgc |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46817819 |
aatatgtgatgctaaatcaaagtaggtcattttggatgccactttataaacatttaatttaatttaaaaatgcttagccaaagcccaaattgtgttctgc |
46817720 |
T |
 |
| Q |
108 |
agaggccacatcatgcaaatcctacctacttaaatcagttaaactcttacatttcgcattgattagatatggtagttgaacttcttaaccaaccatcata |
207 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46817719 |
agatgccacatcatgcaaatcctacctacttaaatcagttaaactcttacatttcgcattgattagatatggtagttgaacttcttaaccaaccatcata |
46817620 |
T |
 |
| Q |
208 |
catactaataatcttcacttc-ttttatcaatgtcttctatctat |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46817619 |
catactaataatcttcacttctttttatcaatgtcttctatctat |
46817575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University