View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1309-Insertion-1 (Length: 171)
Name: NF1309-Insertion-1
Description: NF1309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1309-Insertion-1 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 57 - 171
Target Start/End: Complemental strand, 41701674 - 41701560
Alignment:
| Q |
57 |
tcaaaccaataaatgatgaatatacaccacttgctaacttttttccccacatgttcccctctattggaggactattgactcgaattagcgacactttatt |
156 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41701674 |
tcaaaccaataaatcatgaatatacaccacttgctaacttttttccccacatgttcccctctattggaggactattgactcgaattagcgacactttatt |
41701575 |
T |
|
| Q |
157 |
gttgacattgtatca |
171 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41701574 |
gttgacattgtatca |
41701560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 41701720 - 41701687
Alignment:
| Q |
8 |
cacttatcatctgcatatatatactagattctcc |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41701720 |
cacttatcatctgcatatatatactagattctcc |
41701687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University