View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13090_high_28 (Length: 243)
Name: NF13090_high_28
Description: NF13090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13090_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 231
Target Start/End: Complemental strand, 33815554 - 33815340
Alignment:
| Q |
17 |
agctttcaccatggtgcaagctctgaatcaagatgccatgttcatttgtgggaactggcacaccagaggaatgaactaacatcacatcttctccaaacac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815554 |
agctttcaccatggtgcaagctctgaatcaagatgccatgttcatttgtgggaactggcacaccagaggaatgaactaacatcacatcttctccaaacac |
33815455 |
T |
|
| Q |
117 |
tgttttgatgtctagtggccctgcttgaatttctgttgcaatcccattgataaacactgttgccaatcctgttacagtactagcacctccaaatccttaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815454 |
tgttttgatgtctagtggccctgcttgaatttctgttgcaatcccattgataaacactgttgccaatcctgttacagtactagcacctccaaatccttaa |
33815355 |
T |
|
| Q |
217 |
taataccaaaatatt |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33815354 |
taataccaaaatatt |
33815340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 128
Target Start/End: Original strand, 9376963 - 9377074
Alignment:
| Q |
17 |
agctttcaccatggtgcaagctctgaatcaagatgccatgttcatttgtgggaactggcacaccagaggaatgaactaacatcacatcttctccaaacac |
116 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||| ||| ||||| || ||||||| || |||||||||||||| || || |||||||| ||||||| |
|
|
| T |
9376963 |
agctttcaccatgctgcaagttctgcatcaagaaaccaaactcattggttggaactgagactccagaggaatgaaccaatattacatcttcaccaaacat |
9377062 |
T |
|
| Q |
117 |
tgttttgatgtc |
128 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
9377063 |
tgttttcatgtc |
9377074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University