View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13090_low_26 (Length: 250)
Name: NF13090_low_26
Description: NF13090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13090_low_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 250
Target Start/End: Original strand, 35196818 - 35197052
Alignment:
| Q |
17 |
tgatgttacatattcaacaaaactttaagatatagaatgtttacttaaatat-attatgttatatggcccatatgtcatatgcttcgcaatacatattat |
115 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35196818 |
tgatgttacatatccaacaaaattttaggatatagagtgtttacttaaatattattatgttatatggcccatatgtcatatgcttcgcaatacatattat |
35196917 |
T |
|
| Q |
116 |
aatggactctaagaatactataaattaataaagggtataatgtaagcacataatttataagacatgatcattaaaatttaaaaatcataattattattaa |
215 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35196918 |
aatggacactaagaatactataaattaataaagggtataatgtaagcacataatttataagacatgatcattaaaatttaaaaatcataattatttataa |
35197017 |
T |
|
| Q |
216 |
tagaaacttcatatctgcatatatgatctgtggac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35197018 |
tagaaacttcatatctgcatatatgatctgtggac |
35197052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University