View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13090_low_28 (Length: 248)
Name: NF13090_low_28
Description: NF13090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13090_low_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 18291053 - 18291284
Alignment:
| Q |
1 |
aattccaatgtatggacatttgtctcatcaacatgctcccatagcttcaaatttataaatttccataagctccacaaaatgattgcaaatctttcacgtt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| | ||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
18291053 |
aatttcaatgtatggacatttgtctcatcaacatttttccatagcttcagatttatgaatttccataagcttcacaaaatgattgcaaatctttcatgtt |
18291152 |
T |
 |
| Q |
101 |
gaaatgcatgta-tctatgcaaaggcataaacatcgcaacctccatattataatgtccccatagtgctttatcaatctcttcccataaatttgttgcacg |
199 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18291153 |
gaaatgcatggaatctatgcaaaggcataaacatcacaacctccatattttaatgtccccatagtgctttatcaatctcttcccataagtttgttgcacg |
18291252 |
T |
 |
| Q |
200 |
ccacacttgcactgctctaagacactccaaca |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18291253 |
ccacacttgcactgctctaagacactccaaca |
18291284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University