View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13090_low_32 (Length: 240)
Name: NF13090_low_32
Description: NF13090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13090_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 134 - 224
Target Start/End: Complemental strand, 7407385 - 7407295
Alignment:
| Q |
134 |
gatttcacttatgaatcaaactgggatactgttcaggaaatttgatcttgaatgatgtttatcaataatttgagttcaactacctaataat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7407385 |
gatttcacttatgaatcaaactgggatactgttcaggaaatttgatcttgaatgatgtttatcaataatttgagttcaactacctaataat |
7407295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 7407518 - 7407448
Alignment:
| Q |
1 |
tgatttttatgatatttatttgttccttgctgagacatatgtattttgtgtggtaacgctctagttgctta |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7407518 |
tgatttttatgatatttatttgttccttgctgagacatatgtattttgtgtggtatcgctctagttgctta |
7407448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University