View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13090_low_34 (Length: 227)
Name: NF13090_low_34
Description: NF13090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13090_low_34 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 3 - 227
Target Start/End: Complemental strand, 7407833 - 7407606
Alignment:
| Q |
3 |
atgtgtatcatatcattagacataaaatataagtatttcctttgaatcccttnnnnnnnnnngtatttcctttgaattcaatgtctttttatattatta- |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
7407833 |
atgtgtatcatatcattagacataaaatataagtatttcctttgaatcccttaaaaaaaaa-gtatttcctttgaattcaatgtctttttatattttttt |
7407735 |
T |
 |
| Q |
102 |
---agagcaatgtcttattatatggcaaccttttaattaattgttgctgtcaaaaatctttgaatgcatttgctatttttgattgatcgacacgttaatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7407734 |
ttgagagcaatgtcttattatatggcaacctttgaattaattgttgctgtcaaaaatctttgaatgcatttgctatttttgattgatcgacacgttaatt |
7407635 |
T |
 |
| Q |
199 |
aatgatttgtgagtccatagaccatatat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7407634 |
aatgatttgtgagtccatagaccatatat |
7407606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University