View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13091_high_15 (Length: 232)
Name: NF13091_high_15
Description: NF13091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13091_high_15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 4 - 232
Target Start/End: Original strand, 1157828 - 1158064
Alignment:
| Q |
4 |
catttttctcataagaatttttgcataatcttctttcttatttggttacttccattgtaaggnnnnnnnnnnn-tctgttgaccagtttgcaaactgtaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1157828 |
catttttctcataagaatttttgcataatcttctttcttatttggttacttccattgtaaggaagaaaaaaaaatctgttgaccagtttgcaaactgtaa |
1157927 |
T |
|
| Q |
103 |
agttaatccaattagtgggtgaagcatctgggttggcttttgttaaagctctctcccaacccaaacccctttctatcttctaacctttt-------tcat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1157928 |
agttaatccaattagtgggtgaagcatctgggttggcttttgttaaagctctctcccaacccaaacccctttctatcttctaacctttttgtttcctcat |
1158027 |
T |
|
| Q |
196 |
cttaaattgtcccatttcaaaagagccttggaagttt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1158028 |
cttaaattgtcccatttcaaaagagccttggaagttt |
1158064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University